ID: 1087733612

View in Genome Browser
Species Human (GRCh38)
Location 11:101806796-101806818
Sequence TTAGATTTCCAGTTGCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087733610_1087733612 -8 Left 1087733610 11:101806781-101806803 CCTCTGAAACAGTTCTTAGATTT 0: 1
1: 0
2: 1
3: 25
4: 283
Right 1087733612 11:101806796-101806818 TTAGATTTCCAGTTGCTGGATGG 0: 1
1: 0
2: 1
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087733612 Original CRISPR TTAGATTTCCAGTTGCTGGA TGG Intronic
902261426 1:15227599-15227621 TTAGATTTGCAGTTCTGGGATGG - Intergenic
903437449 1:23361714-23361736 TCAGATTTCCAGTTACTTGTGGG + Exonic
903919942 1:26792621-26792643 TTAGATTTCTTTTTGCTGGCCGG - Intronic
907706234 1:56834987-56835009 TGGGAGCTCCAGTTGCTGGAAGG - Intergenic
908031491 1:60004782-60004804 AGAGATTTCCAGGTGTTGGAGGG + Intronic
908160847 1:61407096-61407118 TTAGACTGCAAGTTCCTGGAAGG - Intronic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
911219129 1:95228512-95228534 TTAGATTCCAAGTGCCTGGAGGG + Intronic
911846285 1:102755368-102755390 TGAGATTTCCAGTTGCTTAATGG - Intergenic
912949377 1:114110292-114110314 TTAGAATACAAGTTCCTGGAGGG - Intronic
916345705 1:163788909-163788931 TAAGGTTTACAGTTGCTGGGTGG + Intergenic
918023200 1:180715508-180715530 TTGGATTTTCAGTTTCTGGAGGG + Intronic
923304729 1:232677893-232677915 TTAGAATGCTAGTTGCTGGGTGG + Intergenic
1064140317 10:12784909-12784931 TCAGATTTCACGCTGCTGGAGGG - Intronic
1064657673 10:17572109-17572131 CTAGATTTTAAGTTCCTGGAGGG + Intergenic
1064760512 10:18614858-18614880 TGAGATTTCCAGTTGAGGGTAGG - Intronic
1065276070 10:24086928-24086950 TTAGATTTCCAGCTGGTACAGGG + Intronic
1065881159 10:30038956-30038978 TTAGAAGTGCAGTTGCAGGAAGG - Intronic
1066792512 10:39081375-39081397 ATAGATTTTCAGATGTTGGATGG + Intergenic
1069023455 10:63515157-63515179 CTAGACTTCCAGTTGTGGGAAGG - Intergenic
1070288350 10:75099540-75099562 CTAGAATTCCAGGTGCTGGCTGG + Intronic
1073889879 10:108089124-108089146 TGAGAGTTCCAGTTGCTCCATGG - Intergenic
1074173064 10:110963925-110963947 TTAGATTGCAAGTTTCTTGAAGG + Intronic
1075293766 10:121254166-121254188 TGAGGTCACCAGTTGCTGGAAGG - Intergenic
1076079789 10:127568790-127568812 TAAGATATTCAGTTGCTGGAAGG + Intergenic
1078115244 11:8442300-8442322 TTAAAGTTCCAGTTGCTCTATGG + Intronic
1078570907 11:12457383-12457405 ATGGATTTCCAGTTGCTGACAGG + Intronic
1078648537 11:13165674-13165696 TTACATTATAAGTTGCTGGAGGG - Intergenic
1080419808 11:32099740-32099762 TTAGTTATCCAGGTGGTGGAAGG + Intronic
1080719987 11:34839194-34839216 AAATATTTCCAGTTGCTGGGAGG + Intergenic
1080804473 11:35639922-35639944 TCAGATTTCAAGTTGGAGGATGG - Intergenic
1080935780 11:36861986-36862008 TTAAAGTGCCAGTTGCTAGATGG - Intergenic
1087733612 11:101806796-101806818 TTAGATTTCCAGTTGCTGGATGG + Intronic
1088418897 11:109620582-109620604 TTAGATTTCCAGTCTTTGAATGG + Intergenic
1092092809 12:5817762-5817784 CTGCATTTCCAGTTGCTGGATGG - Intronic
1093556215 12:20477423-20477445 CTAGCTTTCCAGTTGCTGATCGG + Intronic
1093781344 12:23140893-23140915 TCAGATTTCTAGTTCTTGGAAGG + Intergenic
1096023479 12:48341514-48341536 TTAGCTTTTCAGCTGCTGCAGGG - Exonic
1097606767 12:61764696-61764718 TTAGATTTTCATTTTCTGAAAGG - Intronic
1101610594 12:106287829-106287851 TTAGATTTTTAGTGTCTGGAAGG - Intronic
1105326758 13:19377359-19377381 TAAGATATCCACTTGCAGGATGG + Intergenic
1105846325 13:24297355-24297377 TAAGATATCCAGTCCCTGGAAGG - Exonic
1106342862 13:28847804-28847826 TTATACTTCCTGATGCTGGATGG + Intronic
1106462629 13:29985970-29985992 TTAGATTTCTAGTTTCTTGAGGG + Intergenic
1106665912 13:31850664-31850686 TTAGACTTCAAGCTGCAGGAGGG + Intergenic
1108762052 13:53579836-53579858 CTAGATTTGCAGTTGGTGAATGG + Intergenic
1110606086 13:77434467-77434489 TCAGATTTCCAGTTGCTCTCTGG + Intergenic
1114570442 14:23663666-23663688 GTAGGTTTCAATTTGCTGGAGGG + Intergenic
1114659548 14:24335543-24335565 TTTGATTCCCAGTTGCTGTTCGG - Intronic
1114767919 14:25395436-25395458 TGAGGTTTCCTGTTGCTGCAAGG + Intergenic
1117155898 14:52940852-52940874 TGAGAGTTCCAGTTGCTGTCAGG - Intronic
1117355393 14:54919163-54919185 TTAGATTTCAAGTGTGTGGAGGG - Intergenic
1117608069 14:57452371-57452393 TCATATTTCCAGTTGGAGGATGG - Intergenic
1119343652 14:73903043-73903065 TTAGATTTCCATCTTCTGAAAGG - Intronic
1120263040 14:82212718-82212740 TTGGATTCCCAGTTGCTAGTGGG + Intergenic
1120443656 14:84566926-84566948 TTAGGTTTCCACTTCATGGAAGG - Intergenic
1120865604 14:89293143-89293165 TTCTGTTTCCAGATGCTGGAGGG + Intronic
1122020549 14:98834447-98834469 TTAGCCCTTCAGTTGCTGGATGG + Intergenic
1122477856 14:102024083-102024105 TTGGATTTCCAGCCGGTGGAAGG + Intronic
1125095914 15:35851009-35851031 TTAGATTTCCAGATACAGAAGGG + Intergenic
1125371350 15:38981366-38981388 TTGGTTTTCCATTTGCTTGATGG + Intergenic
1125793408 15:42386802-42386824 GAAAATTTCCAGTAGCTGGATGG - Intronic
1128674885 15:69601226-69601248 GTAGATTTTCAGTTCCTTGAGGG + Intergenic
1129076649 15:73002633-73002655 TATGTTTTCCAGCTGCTGGAGGG + Intergenic
1130217590 15:81986911-81986933 ATAGATTTCCAAGAGCTGGAAGG + Intergenic
1130298389 15:82662996-82663018 TTTGAGTCCCAGCTGCTGGATGG - Intronic
1131619232 15:94049385-94049407 TTAGAATTCCAGTTGCCTGCAGG - Intergenic
1135090007 16:19506356-19506378 TAAGATTTACAGTTGCCGGCAGG + Intronic
1137464302 16:48694085-48694107 TTAGATTTCCATGTGCTAGGAGG - Intergenic
1138892605 16:61163789-61163811 TTAGATTTCTAGATGCTTGAAGG - Intergenic
1141460541 16:84176389-84176411 TGAGCTTTCATGTTGCTGGAGGG + Intronic
1147472948 17:40680911-40680933 TTTAATTTCCACTTGCTGGTGGG + Intergenic
1148361074 17:47012642-47012664 TTTGATTTGCATTTCCTGGATGG - Intronic
1150207720 17:63421393-63421415 TGGGATCTCCATTTGCTGGATGG - Exonic
1152439599 17:80297984-80298006 TTAGATTTACTGTTGCCAGATGG + Intronic
1155276884 18:24197049-24197071 AAAGTTTTCCAGTTGCTGGCCGG + Intronic
1155886416 18:31214488-31214510 TTACATTTCCAATGGCTGGGGGG + Intergenic
1156235256 18:35197065-35197087 TTAGATTGCCAGTTGATGCTCGG - Intergenic
1156459054 18:37311191-37311213 TTAGATTTTCAGCTGTGGGAGGG - Intronic
1156741022 18:40327878-40327900 TTAGATTTCTAGTTGAGGGAAGG + Intergenic
1156770809 18:40721563-40721585 TTATTTTTCTAGTTACTGGAGGG - Intergenic
1156970633 18:43150510-43150532 TTAGATTTCAAATTGCTGAGGGG + Intergenic
1157213306 18:45762000-45762022 TTAGATTTCAAATTCCTGCAGGG - Intergenic
1164743041 19:30590840-30590862 TTAGATGTCCAGCTGTTGAAGGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165614025 19:37182832-37182854 TTAGATGCACAGTTGCTGGGTGG - Exonic
1166920817 19:46227802-46227824 CTAGATATCTAGTTTCTGGAGGG - Intergenic
1168436754 19:56323998-56324020 TATGATTTAAAGTTGCTGGAGGG - Intronic
927189460 2:20507239-20507261 TTTGATTTACATTTCCTGGACGG - Intergenic
927739200 2:25552372-25552394 GTAGGGTTCCAGGTGCTGGATGG - Intronic
928549953 2:32360223-32360245 GTAGATTTGCAGTTGAAGGATGG + Intronic
929060198 2:37915804-37915826 GTAAATTTCCAGTTGCTCAAGGG + Intergenic
929266302 2:39922294-39922316 TTATATTTCAAGCTTCTGGAGGG + Intergenic
929584859 2:43107181-43107203 GTTGGTTTCCAGTTCCTGGACGG - Intergenic
931945594 2:67303044-67303066 TTAGATTTTAAGTTCCTTGAAGG - Intergenic
934786421 2:97011807-97011829 TTAGTTAGCCAGTTGCTGAATGG + Intronic
934813602 2:97305326-97305348 TAAGATGGCCAGATGCTGGAAGG - Intergenic
934824093 2:97403154-97403176 TAAGATGGCCAGATGCTGGAAGG + Intergenic
937186143 2:120044795-120044817 CTAGATTTCTGGTTACTGGAAGG - Intronic
937844888 2:126568885-126568907 TTAAATTTGCATTTCCTGGATGG - Intergenic
939213289 2:139206801-139206823 ATGGATTTTCAGTTCCTGGAGGG + Intergenic
940923862 2:159341949-159341971 TTGCATTTCCAGTTACTTGAAGG - Intronic
941038444 2:160592734-160592756 TTAGATTTACATTTCCTTGATGG + Intergenic
941415069 2:165210184-165210206 GTAGTTTTCCAGATGTTGGAGGG - Intergenic
941628072 2:167851898-167851920 AAAACTTTCCAGTTGCTGGAGGG + Intergenic
942550516 2:177111232-177111254 AAAGATTTCCAGGAGCTGGAAGG + Intergenic
943136691 2:183922349-183922371 TTAATTTTCCAATTGCTGGTTGG - Intergenic
943780908 2:191822771-191822793 TTGTATTTCCAGTTGCTGCTTGG - Intergenic
943938390 2:193956990-193957012 TGTGTTTTGCAGTTGCTGGATGG + Intergenic
944921410 2:204417153-204417175 TTGGCTTTCCTGTTGCTGGCTGG - Intergenic
944923068 2:204435639-204435661 TTTGATCTCCTGATGCTGGAGGG - Intergenic
945980354 2:216305146-216305168 TTAGATTACAAGCTGCAGGAGGG + Intronic
946520420 2:220458415-220458437 ATTGATTCCCAGTTGATGGAAGG - Intergenic
1169105317 20:2989518-2989540 TGCTATTTCCAGTGGCTGGAAGG - Intronic
1172413837 20:34747745-34747767 CTAAATTTCCATTTGCTGGGAGG - Intronic
1174133577 20:48362997-48363019 TTAGGTGGCCAGTTGCTGGGTGG + Intergenic
1174688228 20:52476221-52476243 TTAGAATTTCTGTTCCTGGAAGG + Intergenic
1176055328 20:63142523-63142545 TTAGATTTCCACTTGACGGCAGG + Intergenic
1178696958 21:34801576-34801598 TTAGCTTTTCAGGTGCTGGAGGG + Intronic
1180138135 21:45874747-45874769 TTTGATTTTCCGTTGCTGGCTGG + Intronic
1180993929 22:19955208-19955230 TTAGATTCCCAGAGGCTGGATGG + Intronic
1181360240 22:22328488-22328510 TTTGGTTTCCATTTTCTGGAAGG + Intergenic
1182254044 22:29025345-29025367 TTTGATATCCAGCTGCTGGCTGG + Intronic
1182909980 22:33974997-33975019 GTATATTTCCAGTAGCTAGAAGG + Intergenic
1183400226 22:37599297-37599319 TTAGAGTTGCAGCTGCTGGGGGG - Intergenic
1185008985 22:48302655-48302677 TTTGATTTCTAGCTCCTGGAAGG - Intergenic
949722337 3:7004923-7004945 TTAGATTTCAGGCTGCTGGCTGG + Intronic
952191185 3:31025037-31025059 TTTGATTTCCAAATGTTGGATGG + Intergenic
955021585 3:55126855-55126877 TTATATTTCCATTTGGAGGATGG + Intergenic
955215914 3:56984944-56984966 TTAGATTTCCAGTATCTGGAAGG - Intronic
955768378 3:62368006-62368028 TTAGAATTCCATTTCCTGAAAGG - Intergenic
956744107 3:72298117-72298139 TAAGATCTACAGTTGCTGGCTGG + Intergenic
957963012 3:87283451-87283473 TTAGATACCCAGTTTCTCGACGG - Intergenic
958997670 3:100924017-100924039 TTAGATTTGAATTTGCGGGAAGG - Intronic
960519350 3:118637241-118637263 GGAGTTTTCCTGTTGCTGGAAGG - Intergenic
963184310 3:142396053-142396075 TGATATTTACAGCTGCTGGATGG - Intronic
965757397 3:172040248-172040270 GTAGATTTCCATATGGTGGAGGG + Intronic
966838111 3:184065350-184065372 TTGGATTTCCAGAAGATGGAAGG - Intergenic
967124842 3:186414124-186414146 TTAGGTCTCCAGAGGCTGGATGG - Intergenic
968560410 4:1277933-1277955 TCAGACTGACAGTTGCTGGATGG - Intergenic
971007242 4:22388937-22388959 TTTCTTTTCCAGTTGCTGGATGG - Exonic
971209503 4:24602198-24602220 TTAGATTTTCTCTTGCAGGAGGG + Intergenic
971457117 4:26855598-26855620 TGAAATTTCCAGTCCCTGGATGG + Intergenic
971556925 4:28024239-28024261 TTAAATTTACAGTTTCCGGAAGG + Intergenic
972730489 4:41789845-41789867 TTAAATTTTCAGTTGATGGGTGG + Intergenic
973762321 4:54129662-54129684 TTCTATTTCCAGTTTTTGGAGGG + Intronic
974118923 4:57614339-57614361 TTATTTATCCTGTTGCTGGAGGG + Intergenic
975685320 4:76915319-76915341 GTAGATTACAAGTTTCTGGAGGG - Intergenic
976134018 4:81915482-81915504 TTAGATTTCTAGATGCTAGAAGG - Intronic
976573953 4:86646592-86646614 TGAAACTTCCAGTTGCTGGCTGG - Intronic
979079463 4:116316027-116316049 GTAGATTTCCAGTTGCCCCATGG - Intergenic
980144817 4:128969274-128969296 TTAAATTTCCTATTGCTGGCCGG + Intronic
981805439 4:148709892-148709914 TAAAATTTCCATTTGCTGGATGG - Intergenic
982988535 4:162241592-162241614 GCAGCTTTCCAGTTGCTGAATGG - Intergenic
983312633 4:166084112-166084134 TTTGATTTGCATTTTCTGGATGG + Intronic
985086975 4:186323884-186323906 TTAGATAAACAGTTGCAGGAGGG + Intergenic
988513943 5:31889158-31889180 TCAGATTTCAAGTGGCTGGGTGG - Intronic
989276702 5:39598491-39598513 TGATACTTCCAGTTGCAGGAGGG - Intergenic
991552951 5:67862522-67862544 TAAGAATTCCAGTTGCTTCATGG + Intergenic
995503870 5:112838183-112838205 CTGGATTTTCTGTTGCTGGATGG - Exonic
995840667 5:116440543-116440565 TTTCATTTCCATTTGCTAGAGGG + Intergenic
997150929 5:131494275-131494297 TAAAATTTCAAGTTGCTTGAAGG + Intronic
998305024 5:141067129-141067151 TTATTTTTCCTGTTGTTGGACGG - Intergenic
998573526 5:143288413-143288435 TTAAATTTCCAATTTCTGGCCGG - Intronic
1001655537 5:173345971-173345993 TTGGATTTTCAGCTGCAGGAAGG - Intergenic
1003226448 6:4210361-4210383 TTAGATTTTGAGCTCCTGGAGGG + Intergenic
1006452141 6:34111524-34111546 TAAGAGTTCCAGCTGCTTGATGG - Intronic
1007288358 6:40764778-40764800 TTGGATTTCCAGTTATTGAATGG - Intergenic
1013500120 6:110740902-110740924 TTAGTTTTCCTGGTGGTGGAAGG - Intronic
1013585583 6:111575670-111575692 TTAGAGTTCCTCTGGCTGGAGGG + Exonic
1015261047 6:131238741-131238763 TTTGTTTTCCATTTGCTTGATGG + Intronic
1015479444 6:133691681-133691703 TTACATTTGTAGTTGCCGGATGG - Intergenic
1016379263 6:143457529-143457551 TTTGTTTTGCAGTTGCTAGAGGG + Intronic
1017066954 6:150537895-150537917 TTAGTATTCCAGTTACTGGGAGG - Intergenic
1018775607 6:167012328-167012350 TGAGATTTCTAGTTGGTGTAGGG + Intronic
1019171350 6:170134898-170134920 TCAGATCTGCAGCTGCTGGAGGG - Intergenic
1022407352 7:30103091-30103113 AGAGATTACCAGGTGCTGGAGGG + Intronic
1022707845 7:32822278-32822300 CTAGATTTCAAGTTTCTTGAGGG - Intergenic
1022915118 7:34941063-34941085 CTAGATTTCAAGTTTCTTGAGGG + Intronic
1024690855 7:51801766-51801788 GAAAATTTCCAGTTGCTTGAGGG + Intergenic
1025588428 7:62823265-62823287 TTAAATTTCCATTTGCAGAATGG - Intergenic
1026504759 7:70973062-70973084 TTAGTTGCCCATTTGCTGGAGGG + Intergenic
1028861501 7:95656998-95657020 TTAGACTGTGAGTTGCTGGATGG - Intergenic
1031603611 7:123743619-123743641 TTAGATTTCCTGTTACTGGCAGG - Intronic
1031776897 7:125917107-125917129 TTATATTTCCAGTTTCTAAAAGG + Intergenic
1032706627 7:134425565-134425587 TTACATTTCCAGTTTCATGAAGG + Intergenic
1032913510 7:136461174-136461196 TTCTATTTCTACTTGCTGGATGG + Intergenic
1036295152 8:7529019-7529041 CTAGAATCCCAGTTTCTGGATGG - Intergenic
1036327411 8:7791972-7791994 CTAGAATCCCAGTTTCTGGATGG + Intergenic
1036436558 8:8739704-8739726 TTTGATATCCAGTTTGTGGAGGG - Intergenic
1038365600 8:26929957-26929979 ATAAATTTCAAGTTGCTTGATGG - Intergenic
1039436491 8:37563021-37563043 TTTGATATGCAGTTGGTGGATGG - Intergenic
1041412547 8:57572572-57572594 TTATTTTCCCAGTTACTGGAAGG + Intergenic
1042535444 8:69854018-69854040 ATATATGTCCAGTTGCTGTAAGG - Intergenic
1043957607 8:86379633-86379655 TTAGATTTTCACTTTCTGGAAGG + Intronic
1048035469 8:130673479-130673501 TTTGATTTCAAGTTGCTGCTAGG + Intergenic
1051111060 9:13637286-13637308 TTAGAATTTCAGTTTCTAGACGG + Intergenic
1051819986 9:21153382-21153404 TTAGATTTCTTCTTGCTAGATGG - Intergenic
1052666603 9:31502834-31502856 TTAGACTGCCAGTGGGTGGAGGG - Intergenic
1054983984 9:71240330-71240352 CTAGATTACAAGTTCCTGGAGGG + Intronic
1055215763 9:73860147-73860169 ATAGCTTTCCAGTTGCTAGAGGG + Intergenic
1056275691 9:84992098-84992120 TTATTTTTCTAGTTGGTGGATGG + Intronic
1057048845 9:91906735-91906757 TTTGGTTTGCAGTAGCTGGAGGG + Intronic
1058791377 9:108449276-108449298 TTGGATTCCCAGATGCTGGATGG + Intergenic
1059889285 9:118783509-118783531 TTACATTTCCAGATGCTCTAAGG + Intergenic
1187149037 X:16665055-16665077 TTTGATTTGCAGTTGCCTGATGG - Intronic
1188029432 X:25247887-25247909 TAAGATATACAGTTGCTGAATGG + Intergenic
1188744755 X:33829096-33829118 TGATACTTCCAGTTGCAGGAGGG - Intergenic
1189186789 X:39061795-39061817 GCAGATTTCCAGGTGCTGCAGGG - Intergenic
1189407405 X:40736971-40736993 TTACAGATACAGTTGCTGGAAGG + Intergenic
1193046113 X:77056314-77056336 TTACATTTCCAGTTGCTCTTAGG - Intergenic
1193204505 X:78732140-78732162 TTATATTCCCAGTTGTTTGAGGG + Intergenic
1194260574 X:91689676-91689698 TTTGATGTCCAGTTTCTTGAGGG - Intergenic
1194378789 X:93168193-93168215 TTAGATTTCTATTTGCTTGTTGG + Intergenic
1195249121 X:103025949-103025971 TCAGATCTCCAGTTGCTTGCTGG + Intergenic
1196947061 X:120837869-120837891 TTAGATTTCTCTTTGCTCGAAGG + Intergenic
1196970705 X:121105184-121105206 TAAGATTTCCAGTAGTTGTAGGG + Intergenic
1197360291 X:125493342-125493364 TCAGGTTTCCATTGGCTGGAAGG - Intergenic
1197750397 X:129959936-129959958 GTAGATTTCCAGTTGGAGGTGGG - Intergenic
1198146957 X:133867517-133867539 CTAGATATGCAGCTGCTGGAGGG + Intronic
1199133024 X:144216909-144216931 TTTGCTTTCCATTTGCTGCATGG + Intergenic
1200579264 Y:4928741-4928763 TTTGATATCCAGTTTCTTGAGGG - Intergenic