ID: 1087735329

View in Genome Browser
Species Human (GRCh38)
Location 11:101826437-101826459
Sequence CTGGCTGAACAAAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087735325_1087735329 -6 Left 1087735325 11:101826420-101826442 CCTCAAATTGTTTGTACCTGGCT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 329
1087735319_1087735329 25 Left 1087735319 11:101826389-101826411 CCAACACCTTACTCAGCCTAGAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 329
1087735322_1087735329 9 Left 1087735322 11:101826405-101826427 CCTAGAGATGGCTTCCCTCAAAT 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 329
1087735321_1087735329 19 Left 1087735321 11:101826395-101826417 CCTTACTCAGCCTAGAGATGGCT 0: 1
1: 0
2: 2
3: 17
4: 177
Right 1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 329
1087735324_1087735329 -5 Left 1087735324 11:101826419-101826441 CCCTCAAATTGTTTGTACCTGGC 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG 0: 1
1: 0
2: 1
3: 38
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087735329 Original CRISPR CTGGCTGAACAAAGGATGGA AGG Intronic
900587781 1:3441530-3441552 CAGGCTGAACAAAGATGGGAAGG - Intergenic
901001381 1:6150586-6150608 CTGGATGGATGAAGGATGGATGG + Intronic
901700108 1:11040771-11040793 GTGGGTGGATAAAGGATGGATGG + Intronic
903033931 1:20482302-20482324 CTGGCTGCAGACAGGAAGGAGGG - Intergenic
904223908 1:28998312-28998334 CTGGCTGAACATAGGATATGAGG + Intronic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
905080210 1:35312723-35312745 CTGTCTCAAAAAAGGAAGGAAGG - Intronic
905749064 1:40445844-40445866 CACACTGAACAAAGGAGGGAAGG - Intergenic
906341613 1:44985995-44986017 CAGGCTGAACAAATGAATGAAGG + Intronic
906442821 1:45864497-45864519 TTGTCTGTACAAAGGATGAAAGG + Intronic
906891277 1:49718014-49718036 ATGGATGAAGAAATGATGGAAGG + Intronic
907045786 1:51299355-51299377 CTGGCTGAGCGACGGATGAACGG - Intronic
908037479 1:60071917-60071939 GTGGCTCAAAAAAGGAGGGAAGG - Intronic
908176275 1:61558378-61558400 CTAGAAGAAGAAAGGATGGAGGG + Intergenic
909323938 1:74325322-74325344 CTGGCTGAGCGATGGATGAAAGG - Intronic
909523375 1:76595065-76595087 CTGGCCGAGCAATGGATGAAAGG + Intronic
909882134 1:80892739-80892761 CTGTCTGAACAGAGAATGCAAGG + Intergenic
910962562 1:92778291-92778313 CTGCCAGAACAAAGAGTGGAAGG + Intronic
911233568 1:95385506-95385528 CTGGCTAGAGATAGGATGGATGG + Intergenic
911310219 1:96283428-96283450 GGGGCCTAACAAAGGATGGAGGG - Intergenic
911762400 1:101631379-101631401 CTGCTTGAATAAAGGAAGGAAGG - Intergenic
912749230 1:112271848-112271870 CTGGCTGGACAAGGGCTGAAAGG + Intergenic
917099265 1:171429319-171429341 CACACTGAACAAAGGAGGGAAGG - Intergenic
917306856 1:173635604-173635626 CTGTCTGGACAAAGGTTGGATGG + Intronic
919323902 1:196081116-196081138 CTGGCTGAGCAATGGTTGAACGG + Intergenic
922193530 1:223340236-223340258 CTGTCTGAACAAAGAAGTGATGG - Intronic
1062943732 10:1444434-1444456 ATGGATGATCAATGGATGGATGG - Intronic
1063279230 10:4607123-4607145 CTGGGTGTCCTAAGGATGGAGGG - Intergenic
1070733120 10:78845375-78845397 CTGGCTGGTCTACGGATGGATGG - Intergenic
1070858652 10:79630148-79630170 CAGCCTGGACAAAGGCTGGAAGG + Intergenic
1072064087 10:91848518-91848540 CTGGCTGCAGAAAGGCTTGATGG - Exonic
1073467311 10:103701675-103701697 CTGGATGAATGATGGATGGATGG - Intronic
1073467354 10:103701923-103701945 CTGGATGAAGGATGGATGGATGG - Intronic
1073467355 10:103701927-103701949 ATGGCTGGATGAAGGATGGATGG - Intronic
1074676264 10:115854857-115854879 CTCCCAGAACAAAGCATGGAGGG - Intronic
1074839027 10:117329939-117329961 CTGTCTCAAGAAAGGAAGGAGGG + Intronic
1075637608 10:124040233-124040255 CTGGATGGACGAAGGATGGATGG - Intronic
1077280610 11:1743449-1743471 ATGGCTGAATGGAGGATGGATGG + Intronic
1077480934 11:2814252-2814274 AGGGCTGAATAAAGGATGGATGG + Intronic
1077551262 11:3201311-3201333 CTGGCGGAGCAGAGGATGGCAGG + Intergenic
1078405484 11:11067033-11067055 CCTTCTGAACAAATGATGGAAGG + Intergenic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1081792673 11:45799417-45799439 ATGGCAGAACTAAGGATGGCAGG - Intergenic
1082200955 11:49366527-49366549 CTAACAGAACAAAGGATGGAAGG - Intergenic
1082770218 11:57202180-57202202 ATGGCTGAACAAAGAATACATGG - Intergenic
1083232027 11:61328376-61328398 GTGGCTGAATAAGTGATGGAAGG - Intronic
1083283658 11:61643697-61643719 CTGATTAAACAAAGTATGGAAGG + Intergenic
1083338626 11:61944266-61944288 CTGTCTCAACAAAGGAGGGAAGG - Intergenic
1084543852 11:69803915-69803937 ATGGATGAATGAAGGATGGATGG + Intergenic
1084543866 11:69804001-69804023 ATGGATGAATGAAGGATGGATGG + Intergenic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1086604683 11:88682279-88682301 GTGGCTGAACTAAGGAGGCAGGG + Intronic
1086654717 11:89339678-89339700 CTATCAGAACAGAGGATGGAAGG + Intronic
1087735329 11:101826437-101826459 CTGGCTGAACAAAGGATGGAAGG + Intronic
1091060028 11:132452513-132452535 CAGGCTGAAAGAAGGAAGGAAGG - Intronic
1091082594 11:132685672-132685694 CTGACTGAATAAAAGATGGGGGG - Intronic
1092388391 12:8053430-8053452 CTGGCAGAAGTAAGGATTGAAGG - Exonic
1093858561 12:24135666-24135688 CTGGATGTTCAGAGGATGGAGGG + Intergenic
1096088196 12:48880497-48880519 CTGGCAAAACAGAGGATGGGAGG - Intergenic
1099591919 12:84603277-84603299 ATGGCAGAGCAAATGATGGAAGG - Intergenic
1100179445 12:92069603-92069625 CTGGTTGAACAAATGAGGGATGG - Intronic
1101383482 12:104235152-104235174 CACACTGAACAAAGGAGGGAAGG + Intronic
1101548656 12:105740963-105740985 CAGGCGGAAGAAAGGATGGAAGG + Intergenic
1103886866 12:124208748-124208770 CTGGCTTAACCAAAGATGGCTGG + Intronic
1104415226 12:128592434-128592456 GTGGATGGACAAATGATGGAAGG + Intronic
1105917274 13:24928212-24928234 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1107758719 13:43652982-43653004 CTGCCTGGGGAAAGGATGGATGG + Intronic
1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG + Intergenic
1111507390 13:89211160-89211182 TTGGATGAACAAAGCATGAAAGG - Intergenic
1113959754 13:114119935-114119957 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959833 13:114120179-114120201 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959875 13:114120319-114120341 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959912 13:114120429-114120451 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1113959954 13:114120569-114120591 CTGGCTGGAGAGAGGAGGGAGGG - Intronic
1116392995 14:44415966-44415988 CTGGCTGAGCAACGGATGAGAGG - Intergenic
1116400148 14:44496826-44496848 CTGGCTGAACTAAGAGTTGAAGG + Intergenic
1116747635 14:48842055-48842077 TTGGCTGTAAGAAGGATGGATGG - Intergenic
1116749500 14:48865563-48865585 CTGACTGAAGAATGAATGGATGG + Intergenic
1117032055 14:51682994-51683016 CTGGCTGACCAAAGAATGGAAGG - Intronic
1117103074 14:52370284-52370306 TTGGCTGGACCAAGGGTGGAAGG + Intergenic
1120092975 14:80355324-80355346 CTCCCTGCACAAAGGAGGGATGG + Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121104157 14:91269929-91269951 CTGGCTCAAAACAGCATGGATGG + Intergenic
1121303072 14:92887273-92887295 CTGACAGAAGAAAGGATGGATGG + Intergenic
1121586739 14:95067963-95067985 CAGGCTGCACAGAGGCTGGAAGG - Intergenic
1121768338 14:96507191-96507213 CTGGCTAAACCAAAGATGGCTGG - Intronic
1122911058 14:104827764-104827786 CTGGCTGAGCAAAGGACAGGAGG - Intergenic
1123118774 14:105907482-105907504 CTGGCAGAACAGAGGAGGGGAGG - Intergenic
1123130542 14:105982135-105982157 CTTGCTGAATAGAGGATGGGAGG - Intergenic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1123580782 15:21713356-21713378 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617431 15:22155979-22156001 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1124072947 15:26412815-26412837 GTGGTTGAACAAAAGTTGGAAGG - Intergenic
1126541881 15:49832848-49832870 CTGGCTGAGCAACAGATGAAAGG - Intergenic
1127689972 15:61385873-61385895 CTGGCTGTAAAAAGGATGGGAGG - Intergenic
1128535554 15:68487301-68487323 CAGACAGAACCAAGGATGGAGGG - Intergenic
1128684461 15:69673366-69673388 CTGGCTAAAGAAAGGCTGGCTGG + Intergenic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129897775 15:79121393-79121415 CTGTCTGATGAAAGGATAGATGG + Intergenic
1129911584 15:79232133-79232155 CTTGCTTAACAAAGGATGATGGG - Intergenic
1130178426 15:81599389-81599411 CTGGTTTTACAAAGGATGGCGGG + Intergenic
1130642326 15:85689892-85689914 CTGGCTGAGAAAGGGAAGGAGGG - Intronic
1132030876 15:98437824-98437846 ATGGCTGGATGAAGGATGGATGG + Exonic
1132030877 15:98437828-98437850 CTGGATGAAGGATGGATGGATGG + Exonic
1202989652 15_KI270727v1_random:447601-447623 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1132904916 16:2277667-2277689 CTGCCTGCACAAAGGAGAGACGG + Exonic
1133661238 16:7919838-7919860 CTGGCAGAAGGAAGGAAGGAAGG + Intergenic
1133900002 16:9965188-9965210 CTGGCAGAACAAAGACTGCAGGG + Intronic
1134063043 16:11210554-11210576 CTTGCTGAACACAGGAGGGCAGG + Intergenic
1134125780 16:11615072-11615094 ATGAATGAACAAAGGAAGGAAGG + Intronic
1134881318 16:17747340-17747362 GTGGCACAACAAAGGAAGGAAGG + Intergenic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136532000 16:30876042-30876064 CTGGAGGAACAAAGGAGGGCCGG + Intronic
1137066848 16:35855702-35855724 CTGGGTGAGCAACGGATGAAAGG - Intergenic
1137732789 16:50701157-50701179 CTGGCTGAATAAATGAATGATGG - Intronic
1137826959 16:51506397-51506419 CAGTGTGAAGAAAGGATGGAAGG - Intergenic
1138483120 16:57317241-57317263 CTGGCTGGGCAAAGGCTGCATGG + Intergenic
1138795247 16:59960037-59960059 ATGGATGAATAAAGGATGGATGG + Intergenic
1138795252 16:59960076-59960098 ATGGATGAATAAAGGATGGATGG + Intergenic
1140498150 16:75408097-75408119 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141606496 16:85156933-85156955 ATGGATGGAGAAAGGATGGATGG - Intergenic
1141642278 16:85348281-85348303 ATGGATGAACAGTGGATGGATGG - Intergenic
1142051998 16:87965078-87965100 CTGGCTGAGCAAAGGTTCCAGGG + Intronic
1142960572 17:3550001-3550023 ATGGATGAATAAATGATGGATGG + Intronic
1142960578 17:3550043-3550065 ATGGGTGAATAAATGATGGATGG + Intronic
1143259671 17:5588715-5588737 CACACTGAACAAAGGAGGGAAGG + Intronic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1143964375 17:10746231-10746253 CTCTCTGAAGAAAGGAAGGAAGG + Intergenic
1145262466 17:21362816-21362838 GTGGATGAACAGAGGATGAATGG + Intergenic
1146279173 17:31533936-31533958 CTGGCTGAAGAAAGTAAGGTTGG - Exonic
1147873709 17:43605907-43605929 CTGGCTGAGCAAAAGAAAGAAGG - Intergenic
1149522492 17:57328274-57328296 ATGGCTGCATGAAGGATGGATGG - Intronic
1150471231 17:65439086-65439108 CTGGCTGCACACAGAAGGGATGG + Intergenic
1150578959 17:66454944-66454966 GTGCCTGACCACAGGATGGAAGG + Intronic
1151509180 17:74547812-74547834 CTGGCTGTTGAAAGGATGAATGG + Intergenic
1151923424 17:77174856-77174878 CACACTGAACAAAGGAGGGAAGG + Intronic
1153356935 18:4147621-4147643 TTGGATGGATAAAGGATGGATGG - Intronic
1154010000 18:10565956-10565978 CTGGCTGAACAAAGGGAAGTAGG + Intergenic
1155230045 18:23763869-23763891 CTGTCTGAAAACAGGATGTAGGG - Intronic
1156408510 18:36805840-36805862 CTTGCTAAACAAAGGAAAGAGGG - Intronic
1156464074 18:37337517-37337539 GTGGGTGAACAAATGAGGGAGGG - Intronic
1156538441 18:37886456-37886478 GTGGCTGAAGAAAAGATGGTGGG + Intergenic
1158171703 18:54607011-54607033 CTGGCTGAGCGATGGATGAAAGG + Intergenic
1158311885 18:56168066-56168088 ATGGCAGAACAAAGAATGGCTGG + Intergenic
1160123392 18:76149576-76149598 TTGGCTCAGCAGAGGATGGAAGG - Intergenic
1160429113 18:78799342-78799364 CTGGCTGAAGTATGGATTGAAGG - Intergenic
1160767901 19:816554-816576 CTGGGTGATGAATGGATGGATGG - Intronic
1160767991 19:816956-816978 ATGGGTGATCAATGGATGGATGG - Intronic
1162872546 19:13597575-13597597 ATGGCTGGAAAATGGATGGATGG + Intronic
1163174096 19:15552177-15552199 CTGGCTGAGCTAGGGGTGGAGGG - Exonic
1163764616 19:19155876-19155898 CTGGCTGGACAAAGCAGGGAGGG - Intronic
1163786338 19:19276855-19276877 CTGGCTGGACTGAGGAAGGAAGG + Intronic
1163855333 19:19697307-19697329 CTGGAGCAGCAAAGGATGGAAGG + Intergenic
1163878874 19:19900490-19900512 CACCCTGAACAAAGGAGGGAAGG - Intergenic
1164032538 19:21420834-21420856 TTGCCTGAACAAAGGAGGCAGGG - Intronic
1164292828 19:23882551-23882573 CTGGCTGAGCAACGGATGAAAGG + Intergenic
1164861088 19:31562759-31562781 CTGGCTCACCAAACCATGGAAGG - Intergenic
1165738705 19:38193342-38193364 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
1166782168 19:45348529-45348551 CTGGCTGAACCAAGCATGGGTGG - Intronic
1166988068 19:46674234-46674256 CTGCCTGAAAAGAGGAAGGATGG - Intergenic
1167277613 19:48548336-48548358 GTGGATGAATAGAGGATGGATGG + Intergenic
1167277666 19:48548660-48548682 ATGGCTGATGAATGGATGGAGGG + Intergenic
1168537948 19:57186972-57186994 CTGGCTGAGCGATGGATGAAAGG + Intergenic
1168588773 19:57615590-57615612 CACACTGAACAAAGGAGGGAAGG + Intronic
925119371 2:1405416-1405438 GTGGATGAAGAATGGATGGATGG - Intronic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927377573 2:22436102-22436124 GTGTTTGAACAAAGGAAGGAAGG + Intergenic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
931447630 2:62340152-62340174 CTGGCTCAAAAATGGAAGGAAGG - Intergenic
932634185 2:73373527-73373549 CTGGTAGAACCAAGGATGGGCGG + Intergenic
933702137 2:85263191-85263213 CTGGCTAGAAAATGGATGGAGGG + Intronic
934733857 2:96677510-96677532 ATGGATTAACAAATGATGGATGG - Intergenic
934885002 2:98016595-98016617 CTGACTGAACATAGGAGGGGAGG + Intergenic
934980277 2:98833744-98833766 CTGCCTGAACAATAGGTGGAAGG + Intronic
935112969 2:100108633-100108655 CTGGCTGGGAAAAGGAGGGAGGG + Intronic
935591678 2:104851157-104851179 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
935889194 2:107657572-107657594 ATGACTGAAGAAAGGAAGGAAGG + Intergenic
936389635 2:112059402-112059424 CTAGATGAACAAAGGGTGAAAGG + Intronic
936563395 2:113561859-113561881 CTGTCTGAAGGAAGGAAGGAAGG - Intergenic
936868622 2:117107376-117107398 ATGGCTGAACATTGGAGGGAAGG + Intergenic
937169610 2:119852358-119852380 CACACTGAACAAAGGAAGGAAGG - Intronic
937804846 2:126127319-126127341 CAAGCGGAAGAAAGGATGGAAGG + Intergenic
938246645 2:129782303-129782325 CCGGCAGAACAAAGACTGGAGGG + Intergenic
939533233 2:143391253-143391275 CTGGCTGAGGAAAGGATTTAAGG + Intronic
939999062 2:148949070-148949092 CTGACTGGACAAACGATGCAGGG - Intronic
940786978 2:157991864-157991886 CTTGGTGAGCAAAGTATGGAGGG + Intronic
942004657 2:171686015-171686037 CTCGCTCAACTAAGAATGGATGG - Intergenic
942135266 2:172919099-172919121 CTGGCTGAGCCAGGGATGGCTGG + Intronic
942190792 2:173467978-173468000 GTGGCTGAATAAATGATTGATGG - Intergenic
942479961 2:176374806-176374828 CTGGCTGAAGAAAGGACAAATGG - Intergenic
943009962 2:182435346-182435368 ATGGCTGAACAGGGGTTGGAAGG + Intronic
943175405 2:184466907-184466929 CTGCCTGAGCAAGGGATGCAGGG - Intergenic
943749185 2:191494062-191494084 GTGGCTCACCACAGGATGGATGG + Intergenic
944108071 2:196101040-196101062 CTGGCACAAGGAAGGATGGATGG - Intergenic
944261374 2:197681386-197681408 CTGTTTGAAGAAAGGATGGAGGG - Intergenic
944495948 2:200307132-200307154 CCGGCTGGAGAAAGGAAGGACGG - Intronic
944997280 2:205308255-205308277 CTGTCTTAATAAAGGAAGGAAGG + Intronic
945224850 2:207523138-207523160 GTGACTGAACAGAGAATGGAGGG + Intergenic
945268987 2:207919819-207919841 CTGGCATAACAAGGGAAGGAGGG + Intronic
946436829 2:219662635-219662657 CTGGCTCAACAAAGAAAGCATGG - Intergenic
947857513 2:233334039-233334061 CTGGCTAGGCACAGGATGGAGGG + Intronic
948270796 2:236671857-236671879 CTGGGTGACCTGAGGATGGAAGG + Intergenic
1169217002 20:3799889-3799911 CTGGCCTATCATAGGATGGATGG + Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1172123879 20:32613893-32613915 CTGGCTGATGAATGGATGGGAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1173840245 20:46152262-46152284 CTGGATGACCCATGGATGGATGG - Intergenic
1174125623 20:48303010-48303032 ATGGATGAAGAATGGATGGATGG - Intergenic
1174125630 20:48303057-48303079 ATGGATGAAGAAAGGATGGATGG - Intergenic
1174915376 20:54648189-54648211 CTGAGTAAACAAAGAATGGATGG - Intronic
1174972244 20:55288791-55288813 CTGGTTAAAGAAAGGATGCAGGG + Intergenic
1175385679 20:58593503-58593525 ATGGATGAAGAAGGGATGGATGG + Intergenic
1175459587 20:59142316-59142338 CTGGCAGACCAAAGGAAGTACGG - Intergenic
1175798956 20:61790121-61790143 ATGGGTGGACAGAGGATGGATGG - Intronic
1176130046 20:63492942-63492964 ATGGATGGACAGAGGATGGATGG + Intronic
1177075728 21:16570668-16570690 CTGCCTGAACAGGGGATGAAGGG + Intergenic
1180182396 21:46123824-46123846 ATGGGTGCATAAAGGATGGATGG + Intronic
1180783506 22:18534702-18534724 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181058598 22:20271339-20271361 CGAGGTGAACAAAGGAGGGATGG - Intronic
1181127073 22:20708753-20708775 CGGCCTGAACAAAGGGAGGATGG - Intronic
1181240408 22:21474054-21474076 CGGCCTGAACAAAGGGAGGATGG - Intergenic
1181931643 22:26406376-26406398 CTGGATCAACAAAGGATGAGTGG + Intergenic
1182022401 22:27091743-27091765 CTGGCTGCAACTAGGATGGATGG + Intergenic
1182033551 22:27179798-27179820 TTGGCTGAAGGAAGGAAGGAAGG + Intergenic
1182104435 22:27679329-27679351 CTGCCTGAACGGAGGAAGGATGG + Intergenic
1182111250 22:27725265-27725287 CTGGCTGGAAACAGGATGCATGG + Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182945674 22:34319467-34319489 CTGGGTGGAGAAAGGATGGGAGG + Intergenic
1183413742 22:37671115-37671137 CTGTCTGGACAAAGGCTGGGAGG + Intergenic
1183896945 22:40977066-40977088 CTGGCTGAATAAACGAATGAAGG - Intergenic
1184189908 22:42887634-42887656 ATGGCTGACCAAAGGAGGGGAGG + Intronic
1184306487 22:43606416-43606438 CTGGGTGAACAAATGAAGAAAGG + Intronic
1184744613 22:46449098-46449120 GTGGATGAACAATGGATGGGTGG - Intronic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
1185137398 22:49080565-49080587 TTGGCAGAAGGAAGGATGGAAGG - Intergenic
949681435 3:6519106-6519128 CACACTGAACAAAGGAGGGAAGG - Intergenic
950862953 3:16166493-16166515 CTGGCTGAAAGTAGGATTGAAGG - Intergenic
951106148 3:18745622-18745644 CTGGCTGAACGGAAGAAGGATGG - Intergenic
951544839 3:23814001-23814023 CTGACTGAAGAAAGGAAGTATGG - Intronic
952964194 3:38610948-38610970 CCGGCTGGACAGTGGATGGATGG - Intronic
953261983 3:41348481-41348503 CTGGCTTTACAGAGGAGGGATGG + Intronic
956036678 3:65100745-65100767 GTGGCTGAATATAGTATGGAAGG - Intergenic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
958258467 3:91351984-91352006 CCAGCAGAACAAAGGAAGGAGGG - Intergenic
960706747 3:120489714-120489736 CCCACTGAACAAAGGAGGGAAGG - Intergenic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
963791574 3:149588197-149588219 CAGGCTGGAGAAAAGATGGAAGG - Intronic
964389663 3:156184264-156184286 CTGGCAGAAAACAGAATGGAAGG - Intronic
965729583 3:171756548-171756570 CGGGGGGAAGAAAGGATGGAAGG + Intronic
968478427 4:823611-823633 CTGGGGGAACACAGGATGGACGG + Intronic
968594664 4:1476224-1476246 ATGGCTGAATGAATGATGGATGG + Intergenic
969200501 4:5600816-5600838 CCTGCTGAGCAAAGGATGGGTGG - Intronic
972763641 4:42131638-42131660 GTGGATGCACACAGGATGGAAGG + Intronic
975220008 4:71804132-71804154 CTGGCTGAGCAATGGATGAAAGG + Intergenic
976366063 4:84233492-84233514 ATGGCTGCAAATAGGATGGAGGG - Intergenic
976621556 4:87133559-87133581 CTGGATGGACAAATGATTGAAGG - Intronic
977899423 4:102402275-102402297 ATGGATGAAGAAAGGAAGGAAGG + Intronic
981111911 4:140944458-140944480 CTGGATGAAGAAAGGATGAAGGG + Intronic
981673554 4:147314909-147314931 CTAGCTGAAGAAAGGATGACAGG - Intergenic
982140578 4:152313710-152313732 CTGGCTGAGAAAAGGATGTAGGG + Intergenic
982240166 4:153292243-153292265 CTGGCTTAACAGAAGATGGCTGG - Intronic
983213628 4:164982226-164982248 CTGGTTAAAAAAAGGAGGGATGG + Intergenic
984055267 4:174920691-174920713 CTGGATGAATAAAGGAAAGAAGG + Exonic
984872180 4:184335563-184335585 CAGGCTGAAGACAGGATGCAAGG - Intergenic
984976584 4:185235846-185235868 CTGGCTGAGCAAGGGATGAAAGG + Intronic
990916953 5:60917355-60917377 CTGGTAGAACATAGGATTGAAGG + Intronic
991249152 5:64540794-64540816 CAGGCAGAAGAAAGGAGGGAGGG + Intronic
992245816 5:74821391-74821413 CTGGGTGGACAAAGAATGAATGG - Intronic
993738290 5:91504281-91504303 TTTGCTGAATAATGGATGGATGG - Intergenic
994106312 5:95953087-95953109 CGGGCTGAGCAGAGGATGGCAGG + Intronic
997988126 5:138520810-138520832 CTGTCTCAAAAAAGGAAGGAAGG + Intronic
1002163424 5:177330871-177330893 CTGGCTGCTGAAAGGAGGGACGG + Intergenic
1002325146 5:178399722-178399744 GAGGCTGACCAAAGGAGGGAGGG + Intronic
1004721404 6:18270597-18270619 CTTGGAGAACAAAGGATGAATGG + Intergenic
1006439849 6:34047239-34047261 CAGGCTGCAGACAGGATGGAGGG - Intronic
1008376190 6:50794892-50794914 CAGGCTAACCGAAGGATGGAGGG + Intergenic
1009628019 6:66161766-66161788 CACACTGAACAAAGGAGGGAAGG + Intergenic
1009745738 6:67812942-67812964 CACACTGAACAAAGGAGGGAAGG + Intergenic
1012034769 6:94120210-94120232 GAGACTGAACAAGGGATGGAGGG + Intergenic
1012502333 6:99902714-99902736 CTGGCTGAACACTTGTTGGAAGG + Intergenic
1013361506 6:109397629-109397651 AAGGCTGAACAAAGGATGTGGGG + Intronic
1014275439 6:119382575-119382597 CTGGCTGAGCAACGGATGAAAGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1016092272 6:139994254-139994276 TTGGCTGAACAAAAGACAGAGGG + Intergenic
1016690066 6:146927589-146927611 CTGGTTGAACAAATGAATGAAGG - Intergenic
1017023330 6:150159525-150159547 CTGGCTGACAGAAGGATGGACGG - Intronic
1017078602 6:150644143-150644165 CTGGCTGACCAAAGTAGGAAGGG - Intronic
1017979756 6:159390425-159390447 ATGGCTGATTGAAGGATGGATGG + Intergenic
1018066750 6:160130015-160130037 TTTGCTGAAGAGAGGATGGAAGG + Intronic
1019947150 7:4338826-4338848 CTGGCGGATCAATGGATGAAAGG - Intergenic
1022170900 7:27829097-27829119 CTGTCTGAATAAAGGATACAAGG + Exonic
1022592764 7:31681470-31681492 GTGGCTGAAGAAAGGAGAGATGG - Intergenic
1022968099 7:35493009-35493031 CTGGCTGAACTGAGGACAGACGG + Intergenic
1023175612 7:37432782-37432804 CTGGCTGAACCGTGGATGAAGGG + Intronic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024343050 7:48286507-48286529 CTGTCTGAAAAAAGGAAGGAAGG - Intronic
1027619736 7:80469742-80469764 CTTGCTGAAAAAAAGTTGGAAGG + Intronic
1028017847 7:85737706-85737728 CACACTGAACAAAGGAGGGAAGG + Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1031526877 7:122833101-122833123 CAGACAGAACAAAGGCTGGAAGG - Intronic
1032125522 7:129189717-129189739 GTGGGTGAGCAAAGGATGGCGGG + Intronic
1033179328 7:139159646-139159668 CTGGCTTAACAGAGGATAGATGG - Intronic
1035278901 7:157765219-157765241 GTGGATGAAAGAAGGATGGATGG - Intronic
1035278952 7:157765458-157765480 GTGGATGAAAGAAGGATGGATGG - Intronic
1035279002 7:157765661-157765683 GTGGATGAAAGAAGGATGGATGG - Intronic
1035279020 7:157765741-157765763 GTGGATGAAAGAAGGATGGATGG - Intronic
1035279067 7:157765953-157765975 GTGGATGAAAGAAGGATGGATGG - Intronic
1035279078 7:157766000-157766022 GTGGATGAAGGAAGGATGGATGG - Intronic
1035279149 7:157766320-157766342 ATGGATGAAGGAAGGATGGATGG - Intronic
1035682507 8:1498239-1498261 CAGGCTGCAAAGAGGATGGATGG + Intergenic
1036102612 8:5803187-5803209 CTGGCAGAGCAATGGATGAAAGG + Intergenic
1036747666 8:11421349-11421371 ATGGATGAACAACAGATGGAAGG - Intronic
1037251568 8:16901475-16901497 TTCACTGAACAAAGGATGAATGG - Intergenic
1038090864 8:24251603-24251625 CTGGCTGAGCGATGGATGAAAGG + Intergenic
1039741583 8:40387907-40387929 CTGGCTGAACAGAGGAGGTGGGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1040584519 8:48726818-48726840 ATGGATGGACAATGGATGGATGG - Intronic
1041381597 8:57258848-57258870 CTGGCTGCACAAAGGGTTGAGGG - Intergenic
1041544895 8:59032010-59032032 CTGGGTGAAAAAGGGATGGTAGG + Intronic
1042921947 8:73928803-73928825 CTGTCTCAACAAAGGAGGGTGGG + Intergenic
1044629215 8:94262621-94262643 CTGTCGGGATAAAGGATGGAAGG + Intergenic
1044806259 8:96011260-96011282 TTGGCAGAGTAAAGGATGGAGGG - Intergenic
1045144335 8:99323325-99323347 CTGTCTCAACAAAGGATAGAGGG + Intronic
1045593834 8:103629899-103629921 CTGGCAGTACAAAGGAAGGCAGG + Intronic
1047306829 8:123659328-123659350 ATGGATGGACAATGGATGGATGG - Intergenic
1048041614 8:130734776-130734798 TTGCTAGAACAAAGGATGGAGGG + Intergenic
1049155280 8:141062486-141062508 CTGGATGGAGAGAGGATGGAAGG + Intergenic
1049350597 8:142162469-142162491 ATGGATGGACAGAGGATGGATGG + Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1049889335 9:53866-53888 CTGTCTGAAGGAAGGAAGGAAGG + Intergenic
1051817304 9:21122901-21122923 CTGGCTGAATAGAAGATAGATGG + Intergenic
1055977543 9:81969520-81969542 CTGGCTGACCAATGGAAGGTTGG - Intergenic
1056508533 9:87280801-87280823 CTGGCAGAACAAAAGACTGAGGG - Intergenic
1057279386 9:93699042-93699064 CTGGCTGGATACAGGATGGACGG + Intergenic
1057973642 9:99581016-99581038 ATCTCTGAACAAAGTATGGAGGG - Intergenic
1059387591 9:113976883-113976905 CTGGAAGATTAAAGGATGGATGG - Intronic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1060059669 9:120447927-120447949 CTGGCTGAAGCAGTGATGGAGGG - Exonic
1060688580 9:125635439-125635461 CAGCCTGAACATAGGGTGGAAGG - Intronic
1060871116 9:127040933-127040955 ATGGATGAACAAACCATGGATGG - Intronic
1061829020 9:133278822-133278844 CACACTGAACAAAGGAGGGAAGG + Intergenic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1186166610 X:6833256-6833278 ATGGATGAAGAAAGGATGAATGG + Intergenic
1187044216 X:15630111-15630133 GTGGCTGAACAAATGATGAAAGG + Intronic
1188085004 X:25893563-25893585 CTGGCTGAGCAATGGATGAAAGG - Intergenic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1189082351 X:37988208-37988230 CTGGCTGTAAATAGGAAGGAAGG + Intronic
1190117640 X:47636768-47636790 CTGGCTGGAGAGAGCATGGATGG + Exonic
1190620288 X:52280785-52280807 CACACTGAACAAAGGAGGGAAGG + Intergenic
1190864040 X:54369659-54369681 TGGGCTGAAGAAATGATGGATGG + Intergenic
1192226076 X:69228929-69228951 CTAGCTGGAAAAAGGAGGGAAGG + Intergenic
1192502481 X:71663073-71663095 CTGGCTGAACAGGATATGGAGGG + Intergenic
1192504268 X:71671427-71671449 CTGGCTGAACAGGATATGGAGGG - Intergenic
1192509684 X:71714449-71714471 CTGGCTGAACAGGATATGGAGGG + Exonic
1192517013 X:71767104-71767126 CTGGCTGAACAGGATATGGAGGG - Exonic
1196329947 X:114460201-114460223 CCGGCTCAAAAAAGGATGTATGG - Intergenic
1197174693 X:123473134-123473156 CAGGCTGATCCAAGGATAGAAGG + Intronic
1199981007 X:152920478-152920500 CTGGCTGATGAAAGGGTGGGTGG + Intronic
1201401893 Y:13612374-13612396 CTGGCTGAGCAATGAATGAAAGG - Intergenic
1201586719 Y:15569208-15569230 CAGGCTGAACAAATGGGGGAAGG + Intergenic
1201968809 Y:19769036-19769058 CTGGATGTACAAAGGAGAGAAGG - Intergenic