ID: 1087736980

View in Genome Browser
Species Human (GRCh38)
Location 11:101845360-101845382
Sequence TCTGAAAAGCAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 13, 3: 67, 4: 580}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087736980 Original CRISPR TCTGAAAAGCAGAATGAGGA AGG (reversed) Intronic
900074930 1:806471-806493 TCTGAAAACCAGCATTGGGATGG + Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900902958 1:5529172-5529194 TCTTTATAGCAGAATGAGAATGG + Intergenic
900908760 1:5579272-5579294 TCTGGAAAGCAGAATGAGCAAGG - Intergenic
901267420 1:7922364-7922386 TCAGAAAGGCAGAGAGAGGAAGG + Intronic
902208004 1:14883901-14883923 TCTGTAAAACAGACTGAGGCTGG - Intronic
904480250 1:30788842-30788864 TGTGCAGAGCAGAAGGAGGAGGG + Intergenic
904702882 1:32368570-32368592 TGTGAAAAGCAGGAGGAGGCAGG + Intronic
905027623 1:34861715-34861737 TCAGAAAAGAAGACTGAGGAAGG - Intergenic
906575697 1:46887214-46887236 TCTTTATAGCAGAATGAGAATGG + Intergenic
906596279 1:47080682-47080704 TCTTTATAGCAGAATGAGAATGG - Intronic
907025298 1:51111956-51111978 TCTAAAAGGTAAAATGAGGATGG - Intronic
907328831 1:53658304-53658326 TCTGGGAAGCAGCTTGAGGAAGG + Intronic
907626384 1:56034453-56034475 TCTGAGAACCAGAAATAGGAAGG + Intergenic
908330484 1:63066032-63066054 TCGGAAAAGCAGAATCACCATGG + Intergenic
908487775 1:64611857-64611879 TCTGTATAGCAGTATGAGGATGG - Intronic
909292798 1:73905259-73905281 ACTGAAGAGGAGAAAGAGGAAGG + Intergenic
909604958 1:77498736-77498758 TGAGAAAAGGAGGATGAGGATGG + Intronic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
911871200 1:103101519-103101541 TGTGAAAATCTGAGTGAGGAAGG + Intronic
912569498 1:110611003-110611025 GCTTAAAGACAGAATGAGGAAGG + Intronic
914438905 1:147685315-147685337 TCTGAACAGAATAATGAGTAAGG + Intergenic
914666235 1:149835206-149835228 TCTCAAAAAAAGAAAGAGGAAGG - Intergenic
914669532 1:149858592-149858614 TCTCAAAAAAAGAAAGAGGAAGG + Intronic
914712620 1:150229071-150229093 TCTGAAGAGGAGGATGATGAGGG - Exonic
915298563 1:154939015-154939037 TCAGAAAATGAGAATGAGGCTGG - Intergenic
916165464 1:161963301-161963323 TATGAAAAGAAGAATGACAAAGG + Exonic
916819241 1:168381967-168381989 TCAGAAAAGCATCTTGAGGAAGG - Intergenic
917260941 1:173168138-173168160 TCTGAACAGAATAATGAGTAAGG - Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
918582942 1:186153661-186153683 TATGAAATGCAGAATGAGCGGGG - Intronic
918703741 1:187636759-187636781 TCTGAACAGCAGAAAGAGGGTGG + Intergenic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
922011156 1:221589200-221589222 GCTGTAAAACATAATGAGGAAGG + Intergenic
922013807 1:221622038-221622060 CCTGAAAAGCAGATTTAAGAAGG + Intergenic
922270774 1:224031376-224031398 TCTGAAAACCAGCATTGGGATGG + Intergenic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924100091 1:240594253-240594275 TCTCAAAACCAGGATGAGGCCGG - Intronic
924268658 1:242309239-242309261 GCAGAAAAGCGGGATGAGGAAGG - Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
1063212464 10:3893492-3893514 TCTGAATAGAATCATGAGGAAGG + Intergenic
1063896621 10:10689100-10689122 TCTTTAGAGCAGTATGAGGATGG - Intergenic
1064361164 10:14666187-14666209 TCTGTATAGCAGCATGAGAATGG - Intronic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1064731516 10:18335908-18335930 TTTGAAGAGAAGGATGAGGATGG - Intronic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1065269910 10:24018063-24018085 TCTGTAAAGCAGAAAGAAGCTGG - Intronic
1065929618 10:30468172-30468194 GCTGAAGAGGCGAATGAGGAAGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068361724 10:55982457-55982479 GCTGAAAACCAGAATGAGAAAGG + Intergenic
1068870971 10:61944069-61944091 TTTGAAAAGGACAAAGAGGAGGG - Intronic
1068916571 10:62438825-62438847 TGTGAGAAGCATACTGAGGAAGG - Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1070191731 10:74117648-74117670 TCTCAAAAAAAGAATGAGCAGGG + Intronic
1070479031 10:76863113-76863135 TCTGTAAAGCAAAAATAGGAGGG - Intergenic
1070869225 10:79734566-79734588 TCTGAAAATCTGAATAAGGGAGG - Intergenic
1071636138 10:87256743-87256765 TCTGAAAATCTGAATAAGGGAGG - Intergenic
1071659103 10:87481203-87481225 TCTGAAAATCTGAATAAGGGAGG + Intergenic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072391704 10:94994000-94994022 TCTGGACAGCAGAAAAAGGATGG - Intergenic
1072432935 10:95389640-95389662 TCTGAAGAAGAGAATGAGGTGGG + Intronic
1073053394 10:100683943-100683965 TCTGAAAACCAGACTAGGGACGG + Intergenic
1073703514 10:105956816-105956838 TGAGAAAAGCAGAATGACCAAGG - Intergenic
1074460233 10:113629942-113629964 TCTGAAAGGCAGCATCATGAGGG + Intronic
1075337208 10:121617153-121617175 TTGGAAAAGGAGAAGGAGGAAGG + Intergenic
1076238306 10:128882952-128882974 TCTGGAAAGCACAATGAGGAAGG + Intergenic
1076420277 10:130326743-130326765 TCTGAAAAGCAATAATAGGAAGG + Intergenic
1079007859 11:16804770-16804792 TCTGAAGAGCAGAATTTGGCTGG - Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079570892 11:21942259-21942281 TCTGAAAAGTAAAAAGAAGAAGG - Intergenic
1079743329 11:24092734-24092756 TATAAAAAGCAAAATGAAGAGGG + Intergenic
1079779045 11:24575254-24575276 TAAGAAAAGCAGAATTAGAAAGG - Intronic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081041894 11:38223741-38223763 TCCGAACAGCAGAAAAAGGATGG - Intergenic
1081073741 11:38642587-38642609 TCTGAAAGGAAGAATAAGGCAGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1084311806 11:68321325-68321347 TTTGAAAAGGACAATGAGGTGGG - Intronic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1084487938 11:69461904-69461926 TCTGAAAAGGGGAAGGAGCATGG + Intergenic
1084746919 11:71176953-71176975 TCTTAAAAGCAGACTAGGGAAGG + Intronic
1085213123 11:74800847-74800869 GCTGAAAGGCTGAATGAAGAGGG - Intronic
1085697220 11:78715283-78715305 TCAGAAAAGCAGAAAGATCAAGG - Intronic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087583359 11:100088231-100088253 TCTGAAAAGCAGTGTTAAGAGGG + Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088108062 11:106228009-106228031 TCTGAACAGTGGAAAGAGGATGG + Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088258782 11:107925907-107925929 TTTGAAAAGGAGAATGATGGAGG + Intronic
1089036536 11:115399680-115399702 TGTTAAAAAAAGAATGAGGATGG - Intronic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089597846 11:119593040-119593062 GCTGGAAAGTAGAGTGAGGAAGG + Intergenic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090080418 11:123608880-123608902 TGTGGAAAGAAGAATAAGGAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1091460573 12:641317-641339 TCTGCAAAGCAGGAGGTGGAGGG - Intronic
1091805440 12:3352716-3352738 TCTGCAATGCTGAATGAGGAGGG - Intergenic
1091868137 12:3860595-3860617 TCTGAAAGGGAGAAAAAGGAAGG - Intronic
1091877663 12:3949633-3949655 TCAGAAAACAAGAATTAGGAAGG - Intergenic
1092633068 12:10406638-10406660 TCTGAAAGGTGGAAAGAGGAAGG + Intronic
1092695025 12:11162095-11162117 TCTGAAAAGGATGATGAGAAGGG - Intronic
1093439113 12:19172722-19172744 TCTGAAAATAAGAATAATGATGG - Intronic
1094382506 12:29858027-29858049 TCTTTAAAGCAGTATGAGAAAGG + Intergenic
1094422772 12:30289274-30289296 TCTGAAAAGAATACAGAGGAAGG - Intergenic
1094631985 12:32184661-32184683 TCAGAAAAACAAAGTGAGGATGG + Intronic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095550990 12:43439349-43439371 TGTGAAAAAGAGAATGAGAACGG + Intronic
1096756940 12:53807549-53807571 GCTGAAGAGAAGAATGAGGAAGG - Intergenic
1096944198 12:55386026-55386048 TCTCAAAAACAAAAAGAGGAAGG - Intergenic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097437421 12:59568346-59568368 ACTGAGAAGCAGAATGAGAGGGG + Intergenic
1098024902 12:66191085-66191107 ACTCAAAAGCAGACAGAGGATGG + Intronic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1098874091 12:75848838-75848860 TCTGGGAAGCAGCATGATGAGGG - Intergenic
1099033085 12:77553502-77553524 TCTGGAAACCAGAATGATAAAGG + Intergenic
1099250014 12:80242932-80242954 TCTTAGAAGCAGAAACAGGACGG - Intronic
1099425580 12:82518920-82518942 TCTGAACAACAGGCTGAGGATGG + Intergenic
1099479693 12:83150436-83150458 TCTGCAAAACAGAATGAGGGGGG - Intergenic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099611896 12:84883820-84883842 GGTGATTAGCAGAATGAGGAAGG + Intronic
1099936061 12:89127102-89127124 TCTGAAATGTACAATGAAGAAGG + Intergenic
1100249456 12:92802426-92802448 TTTGAAAAGGAGAATCAGAAAGG - Exonic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101813330 12:108126703-108126725 TGTGAAAGGGAGAATGAGGTTGG - Intergenic
1102624402 12:114223169-114223191 AATGAAAAGCAAAATGAGAAGGG - Intergenic
1102757506 12:115354783-115354805 TCTGGAAAGGACAATGGGGATGG + Intergenic
1103003983 12:117407268-117407290 ACAGAAAAGCAGAATGATCAGGG - Intronic
1103193311 12:119020819-119020841 TTTGGAACCCAGAATGAGGAAGG + Intronic
1103783597 12:123415753-123415775 CCTTCAAAGCAGACTGAGGAGGG - Exonic
1104161220 12:126182617-126182639 TTTTAAAAGCAGAATAAGGCTGG - Intergenic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1105038573 12:132944157-132944179 TCCGGAAAGCAGGAGGAGGAAGG - Intronic
1105395839 13:20033530-20033552 TGTGAAGACCAGAATAAGGAAGG - Intronic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105947226 13:25200536-25200558 TATGAAAAGCAGAATAGGGCCGG - Intergenic
1106827202 13:33536648-33536670 TCTGAAAAGCAGAATTAAAAGGG + Intergenic
1106883001 13:34152258-34152280 ACTGCAAAGCAGAATGAGAAGGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107263847 13:38527255-38527277 TCTGGAAACCTGAATGAGCAGGG - Intergenic
1107383666 13:39884076-39884098 TCTGAAGAGCAGAAAGAAAAAGG + Intergenic
1107773520 13:43813283-43813305 TCTGAAAAGCATTATAATGATGG + Intergenic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109634090 13:65090621-65090643 TCTGAAGAGAAGAATTAGCAGGG + Intergenic
1110120705 13:71877193-71877215 TATGGAAAGCAGACTGAGGTTGG - Intergenic
1110169157 13:72479758-72479780 TCTTCATAGCAGCATGAGGATGG + Intergenic
1110310994 13:74048899-74048921 CCTGGAAAGCCGAATGAGGGAGG + Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110407598 13:75168226-75168248 AGAGAAAAGCAGAATGAGGCAGG + Intergenic
1110581887 13:77139407-77139429 TCTGCAAAGCAGAAAAATGATGG + Intronic
1110660260 13:78052563-78052585 TTTAAAAAGTAGAATGAGGGAGG - Intergenic
1112105679 13:96236871-96236893 TCTTCAAAGCAGCATGAGAATGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113608304 13:111625983-111626005 TCAGAATAGCAGTATGAGGTGGG + Exonic
1113726626 13:112608268-112608290 TCTGAACAACAGAAAGAAGATGG + Intergenic
1114146062 14:19979652-19979674 GCTGAATAGCAGAAAAAGGATGG + Intergenic
1114832182 14:26157724-26157746 TCTTAAGAGCAGAGAGAGGATGG - Intergenic
1115008510 14:28515859-28515881 TTTGATATGCAGAATTAGGAAGG + Intergenic
1115301622 14:31892100-31892122 TCTAAACTTCAGAATGAGGAGGG + Intergenic
1115311398 14:31982096-31982118 TCTTCATAGCAGCATGAGGACGG + Intergenic
1115356216 14:32450772-32450794 TCTAAAAAGTAGAAGGAGGGAGG + Intronic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1116027240 14:39530056-39530078 TGGGAAAAGCAGTATGAAGAGGG - Intergenic
1116420705 14:44728511-44728533 CCTGAAAAGCAGTATGAAAAAGG - Intergenic
1117124222 14:52603833-52603855 TATGAAAAACAGTATGAGGCTGG - Intronic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118920903 14:70149268-70149290 TGGGAAAAGCAGAATCAGGCTGG + Intronic
1119404274 14:74387009-74387031 CCTGAAAAGAATAATGGGGAGGG + Intergenic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120197614 14:81502740-81502762 TTTGAGAAGCTGACTGAGGAAGG - Exonic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1121230339 14:92352923-92352945 TCTGAAAAGCAGAATGTTGGGGG - Intronic
1121287386 14:92747132-92747154 TCTGGAAAACAGCATGATGAAGG - Intronic
1121412954 14:93760467-93760489 TCTGAAGAGCAGAATAGGGAGGG - Intronic
1121425825 14:93851248-93851270 TCTGAAAAGTTGATGGAGGAGGG - Intergenic
1121878400 14:97476533-97476555 ACTAAAAAGCAGAAAGAAGAAGG - Intergenic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1124946328 15:34270459-34270481 TCTTCATAGCAGCATGAGGAAGG - Intronic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126167019 15:45662453-45662475 TCAGAAAAAGAGAAGGAGGAAGG - Intronic
1126703505 15:51387160-51387182 TCAGCAAAGGAGACTGAGGAGGG + Intronic
1126841244 15:52719359-52719381 TATGAAACGTAGAATGAGTAAGG + Intergenic
1128025133 15:64429371-64429393 TCAGAAAACAAGAATGAGGCTGG - Intronic
1128787054 15:70405379-70405401 TCTGAATAGCAGAGAGAGGAAGG + Intergenic
1129952934 15:79607887-79607909 TTTGAAAAACACAATGAGAAAGG + Intergenic
1131090040 15:89617113-89617135 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
1133436807 16:5786837-5786859 TCTGAAAGGTAGAATGAAGCCGG + Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1134170658 16:11966499-11966521 TGTCAAAATCAGAATGAAGATGG - Intronic
1134866488 16:17611842-17611864 TCTCTAAAGCAAAATTAGGAAGG + Intergenic
1136730856 16:32411096-32411118 TCTGAAAAGTGGAATCAGGCAGG - Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1139061787 16:63262395-63262417 TATAAAAATCAGAATAAGGATGG - Intergenic
1139964151 16:70736347-70736369 TCTGAGACTCAGAATGAGAACGG - Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1202995541 16_KI270728v1_random:106173-106195 TCTGAAAAGTGGAATCAGGCAGG + Intergenic
1203022228 16_KI270728v1_random:418515-418537 TCTGAAAAGTGGAATCAGGCAGG + Intergenic
1143112717 17:4561311-4561333 TCTGACAAGCATAAGGACGAGGG + Intergenic
1143318552 17:6052425-6052447 CCTGAAGCGCAGGATGAGGAGGG + Intronic
1143757060 17:9074912-9074934 TGGGAAACGCAGAGTGAGGACGG - Intronic
1143951292 17:10634663-10634685 TCTGCAAAACAGAATGGGAATGG - Intronic
1144326417 17:14186312-14186334 TCTGGAGAGTAGAATGAGGGTGG - Intronic
1144441141 17:15283156-15283178 TCTCAAAAGCAAAATCAGAAAGG - Intergenic
1144460292 17:15453087-15453109 TGAGAAACACAGAATGAGGAAGG + Intronic
1144475295 17:15583187-15583209 TCTGGAGAGTAGAATGAGGGTGG - Intronic
1144948068 17:18979946-18979968 TCTGAAGAGCAGCATCAGGCAGG + Intronic
1144993789 17:19252611-19252633 TATGAAAATCAGAATTAGGAAGG - Intronic
1146227589 17:31080162-31080184 TCTGATAGGCAAAATGAGAAAGG - Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1148250351 17:46073284-46073306 TCTGTAAAGTAGGATGAGCAAGG + Intronic
1150485789 17:65542697-65542719 TCTTAAAAGCAGAATGGTCAAGG + Intronic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1151563597 17:74884346-74884368 TCTGAAATTCAGAATTAAGAGGG - Intronic
1151929818 17:77225291-77225313 CCTTATTAGCAGAATGAGGATGG - Intergenic
1152007620 17:77692439-77692461 GCTGAAGAGGAGGATGAGGAGGG + Intergenic
1152106804 17:78334960-78334982 TCTGAAATCCAGGATGGGGAGGG - Intergenic
1153384972 18:4482608-4482630 TGGGAAAAGCAGAATGATGCAGG + Intergenic
1153485879 18:5597225-5597247 TCTGAGAAGCAGAATGACTAAGG - Intronic
1154005155 18:10521063-10521085 TTTGAAAAGGAGAAAGAGAACGG - Intergenic
1154124140 18:11674581-11674603 TCTGAAATGCAGACTGAAGGTGG + Intergenic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1154953944 18:21237544-21237566 TCTGAAAACCAGAATGATGTTGG - Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1156055778 18:33000570-33000592 TCTTAAAAGCAGCAAGAGAAAGG + Intronic
1156117421 18:33802776-33802798 TCTCAAAAGAAGACAGAGGAGGG + Intergenic
1156260405 18:35440625-35440647 TCTGAACAGCAGAGTGATGTGGG - Intergenic
1159011322 18:63061600-63061622 GCTGCAAAGGAGAATGAGAAGGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159946873 18:74450547-74450569 TGTGAAAAGCAGAGTGAGGAGGG + Intronic
1161092571 19:2369342-2369364 TGTGAAGAGGAGACTGAGGAGGG + Intergenic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163269007 19:16238615-16238637 TCTGAAAGGCAAAAACAGGAAGG + Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163640161 19:18457483-18457505 TCTGGAAAGCAGAATGAAGTTGG - Intronic
1163785041 19:19270609-19270631 TCAGACATGCAGAATGAGGCAGG - Intronic
1164814491 19:31184882-31184904 TCAGCAGAGCAGAATGAGAAGGG + Intergenic
1165290341 19:34878913-34878935 TTAGAAAAGCAGAATCAGGCAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1167649822 19:50723205-50723227 TCTGGAAAGTGGAAAGAGGAGGG + Intergenic
924978748 2:201057-201079 TATAGACAGCAGAATGAGGACGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925901797 2:8514116-8514138 GATGAGAAGCAGAATTAGGATGG + Intergenic
926527187 2:13995262-13995284 TCTTCATAGCAGAATGAGAACGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
930712489 2:54562019-54562041 TCTGAAAAAGAAAAAGAGGAAGG - Intronic
930862512 2:56089638-56089660 TCTGAAAATAAGACAGAGGAAGG - Intergenic
931220812 2:60286329-60286351 TCTGACAAGCGGAATTGGGAAGG - Intergenic
931451141 2:62368745-62368767 TCTTTATAGCAGTATGAGGATGG - Intergenic
931618507 2:64186487-64186509 TCAGATAAGGAGAAAGAGGAAGG + Intergenic
931653758 2:64491394-64491416 TGGGAAAAGCAGAATTAGAAAGG + Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933296046 2:80492390-80492412 TCTTAATAGCAGCATGAGAATGG + Intronic
933524876 2:83424016-83424038 TCACAAAAGCAAAATGATGAGGG - Intergenic
934165908 2:89294119-89294141 TCAGAAAAGCAGGAGGAAGAGGG + Intergenic
934201369 2:89888337-89888359 TCAGAAAAGCAGGAGGAAGAGGG - Intergenic
934276644 2:91578079-91578101 TCTTAAAAACAGAATGAAAACGG - Intergenic
935624225 2:105156015-105156037 TCTGAAAAGGGGAAGGAAGAAGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936891294 2:117373145-117373167 TCTGAAAAGGAGCATGGGTAGGG - Intergenic
937447136 2:121967981-121968003 TCTAAAAAGCTGAATCAGGCTGG - Intergenic
937925005 2:127161309-127161331 TCTGAAGAGCAGAGAGAGGCTGG + Intergenic
938162958 2:129002917-129002939 TCTCACAAGCGGAAAGAGGATGG - Intergenic
939675735 2:145069841-145069863 TCTGGCAAGCAGAATAAGCATGG + Intergenic
939679088 2:145108460-145108482 TCTGAAAAGAGGAATGTGGTAGG + Intergenic
940172980 2:150848862-150848884 TCTGACAGGCAGAATGAGAGAGG + Intergenic
940346759 2:152636770-152636792 TTAGAAAAGGACAATGAGGACGG - Intronic
940738701 2:157482362-157482384 TCTGAAAGGAAGACTGAGGTGGG + Intronic
940840281 2:158571917-158571939 TCTGAAAGCCAGAAGGAAGATGG + Intronic
941085686 2:161114956-161114978 TTTGAAAAACAAAATCAGGAAGG - Intergenic
941701977 2:168613354-168613376 TGTGAAAAGAAGGCTGAGGATGG + Intronic
941823422 2:169865647-169865669 GCTGGAAAGCAGAAAGAGAAAGG - Intronic
941874698 2:170420815-170420837 TCTAAAAAGCAGAATTAGCATGG - Intronic
942157103 2:173141450-173141472 GCTTAACAGCAGATTGAGGAAGG + Intronic
942166581 2:173246619-173246641 ATTCAAAAGCAGAATTAGGAAGG + Intronic
942363063 2:175193136-175193158 TGTGTGAAGCAGAATGAGCAAGG - Intergenic
943164139 2:184296005-184296027 TATGAAAATGAGAATCAGGATGG - Intergenic
943794432 2:191974018-191974040 TCTTATTAGCAGAATGAGAATGG + Intronic
943968019 2:194363358-194363380 TCTCAAGAGCCCAATGAGGAAGG + Intergenic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
945267859 2:207908938-207908960 TCTTCACAGCAGAATGAGGGTGG + Intronic
945459369 2:210087317-210087339 TCTTAAAAGCAACAAGAGGATGG - Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
945766568 2:213987286-213987308 TGAGAAAGGCAGAATGAGGTAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
948571957 2:238923213-238923235 TCTAAAAAGCATAATGTGGCTGG + Intergenic
949082792 2:242118313-242118335 TCTGAAAACCAGCATTGGGATGG - Intergenic
1168864973 20:1078528-1078550 GCTGAAAATCAGGATGAGGAGGG + Intergenic
1168880605 20:1203364-1203386 TCTGAACAGAACAAGGAGGAAGG - Intergenic
1169100058 20:2939741-2939763 TCTGAAAAGTAGAAAAAAGAAGG - Intronic
1169146673 20:3257141-3257163 CCTGAAAGGCAGGATGAGAAAGG + Intronic
1169294857 20:4386286-4386308 GCTCAACAGCAGAATGAAGAGGG + Intergenic
1169469441 20:5871566-5871588 TCTGAATGGCAGAAAGAAGATGG + Intergenic
1170280126 20:14636978-14637000 GCTGAAATGCAGAATAATGATGG + Intronic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1171079038 20:22159109-22159131 TCCCAAAAGCAGACAGAGGATGG + Intergenic
1171174883 20:23044138-23044160 TCTGAAAAGGCGCACGAGGAAGG - Intergenic
1171233693 20:23507981-23508003 TCTGAAAGTCAGAGTCAGGACGG - Intergenic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172870650 20:38133509-38133531 TCTGAAAAGAACACTGAGGCTGG + Intronic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1173345515 20:42196108-42196130 TCTTAAAAGCAAAATGATTATGG - Intronic
1173966065 20:47113783-47113805 TCTGAAAAGCAGAAACATTATGG - Intronic
1174320581 20:49738873-49738895 TCCGAAAAGGAGAAGTAGGAAGG + Intergenic
1175425281 20:58861037-58861059 TCTAAAAAGAAGAAGGAGCATGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1176990036 21:15484817-15484839 TCTCACAAGCAAAGTGAGGAGGG - Intergenic
1177381167 21:20346357-20346379 AATGAAAAGCAGAATGTGGATGG - Intergenic
1177448735 21:21237051-21237073 TCTGAAAAGCAGAGAAAGCAGGG - Intronic
1177475520 21:21615582-21615604 TCAGAAAAGCAGAAAGAGATGGG + Intergenic
1177657238 21:24034123-24034145 TCTGAAAAACAAAAACAGGATGG + Intergenic
1178782398 21:35616299-35616321 TCTGAAAAGCATATTAAGCAAGG - Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179611251 21:42552783-42552805 GCTGAAAAGCAGGAAGAAGAGGG + Intronic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1182781241 22:32869725-32869747 TCTGGAAAGCAGCAAGAGTAGGG + Intronic
1182972088 22:34588813-34588835 TCTGAAAACCAAAAATAGGAAGG + Intergenic
1183045273 22:35214439-35214461 TCTGAAAAGGAAAATAAGGTAGG + Intergenic
1183138481 22:35913842-35913864 TAAGAAAAGGGGAATGAGGAAGG + Intronic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184721187 22:46314478-46314500 TCTGAAGAGCAGAAAGGCGAAGG - Intronic
1185323621 22:50215076-50215098 TCTTAAAAACAAAATGAGAAGGG - Intronic
949609940 3:5693636-5693658 TTTGAACAGCAGAAAGAAGATGG - Intergenic
949760928 3:7469674-7469696 TCTGTGAACCAGGATGAGGAAGG + Intronic
950332566 3:12168195-12168217 TCTGGAAAACAGATAGAGGAGGG + Intronic
951829883 3:26914797-26914819 TCTGAAAGGTAGAATGGGAAGGG + Intergenic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
953508990 3:43516312-43516334 TCTGAAGAGCAGAAATTGGATGG + Intronic
954489255 3:50886147-50886169 TCTGAAAGGCGGAAAGAAGAAGG - Intronic
954914671 3:54138718-54138740 CCCCAAATGCAGAATGAGGATGG - Intronic
955016245 3:55072953-55072975 TGTGCAAAGCAGTATAAGGAAGG + Intronic
955088292 3:55724353-55724375 GCTAAAAAGCAGAATAAAGAAGG - Intronic
955237686 3:57154373-57154395 TCTAAAAAGGAGAGTGAGAATGG - Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
956056460 3:65303801-65303823 TCAGAAAAGCACAAGCAGGAAGG - Intergenic
956561299 3:70578357-70578379 TCTGACAACCAGAATGACCAGGG + Intergenic
956675893 3:71731441-71731463 ACTGAAAAAAATAATGAGGAAGG - Intronic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
957130101 3:76213462-76213484 TGTGAAAAGAAAAATGAGAATGG + Intronic
957423076 3:79997676-79997698 ACTGAAAAGCAGAAAAAGCAAGG - Intergenic
957884145 3:86261980-86262002 TCTGAATAACAGAATGAGACAGG - Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959890582 3:111550731-111550753 TCAGAAAAGAAGATTGAGGAAGG + Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960365672 3:116769019-116769041 TCTAAATAGAAGAATGATGAAGG + Intronic
960391529 3:117083161-117083183 TCTGAGAAGTAGAATAAGAAAGG - Intronic
962105958 3:132389646-132389668 TATGAAAAGCAGAATTAAGCTGG + Intergenic
962126185 3:132621292-132621314 TCTGAAAAAGAGAAAGAAGAGGG + Intronic
962248432 3:133818949-133818971 TCTGGATAGCAGAAAGGGGAAGG + Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
963442398 3:145356481-145356503 TATGAACAGCAGAAAGAGGGTGG - Intergenic
963924837 3:150940290-150940312 TGTGATTAGCAGAATGTGGATGG + Intronic
964113347 3:153110159-153110181 TCTGAAAAAAAGAAAAAGGAAGG - Intergenic
964171865 3:153779983-153780005 CCTGTAAAGAAGAATGAGGGGGG + Intergenic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
966197366 3:177326713-177326735 TCTGCAAAGCAGTATGTGGACGG - Intergenic
966595014 3:181717964-181717986 TCTGAAAAGCTGAATGAATTGGG - Intergenic
966968767 3:185022311-185022333 TCTTAATAGCAGCATGAGAATGG + Intronic
967207344 3:187136053-187136075 TCTCAAAAGCAGTGTGATGAGGG - Intronic
967394116 3:188987680-188987702 TCTGAAAGGCAGAGAGAAGAAGG - Intronic
967457917 3:189711202-189711224 TCTGAAAAGCAAATTGTAGATGG - Intronic
967840072 3:193998009-193998031 TATGAACAGCAGAGGGAGGAGGG + Intergenic
968039931 3:195580300-195580322 TATCAAAAGCAGAAAGATGATGG + Intronic
970070174 4:12149223-12149245 TCTGAAAAGGGGGAAGAGGAGGG + Intergenic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970663955 4:18316134-18316156 TCTGAAAGGCAGAATCAGAGTGG + Intergenic
971472960 4:27046864-27046886 TCTGATAAACAGATTAAGGAAGG - Intergenic
971511269 4:27427842-27427864 TCTGAAGAGGGGAGTGAGGAAGG - Intergenic
972230494 4:37067086-37067108 TCTGTAAAGCTGAAGCAGGAGGG + Intergenic
972357188 4:38291127-38291149 TCTGAGCATCAGAGTGAGGAGGG + Intergenic
972602321 4:40583561-40583583 TCTTAAAAGCAGAATGGGCCAGG + Intronic
972808967 4:42561995-42562017 TATAAAAAGCAGAAAGATGAGGG - Intronic
972852935 4:43072637-43072659 TCTGGACAGTAGAAAGAGGATGG + Intergenic
973108201 4:46367024-46367046 TCTGAAAAGCAGTAACAGCAGGG + Intronic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973646339 4:52954605-52954627 TCAGAAAAGCAGCAAGAGAAAGG + Intronic
973742068 4:53927671-53927693 TCTGAAAGCCAGAATGGGAATGG - Intronic
974163981 4:58176387-58176409 TCTTTATAGCAGAATGAGAATGG + Intergenic
975119366 4:70711836-70711858 TCACAAAGGCAGAATCAGGAAGG - Intronic
975579823 4:75896283-75896305 TCTGGAAAGCAAAATGATGTTGG + Exonic
976848986 4:89523515-89523537 ACTGAAATGCAGAAAGATGAAGG + Intergenic
976985725 4:91294531-91294553 CCTGAAATGCAAAATCAGGATGG + Intronic
977599193 4:98917665-98917687 TCAGAAAAGAAGATGGAGGAGGG + Intronic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978668532 4:111216467-111216489 ACTAAAACGAAGAATGAGGATGG - Intergenic
979102206 4:116632702-116632724 TCTGAAAAGCACAAGGAGTGTGG + Intergenic
979947292 4:126848972-126848994 TCTGAAAATTTGACTGAGGAGGG + Intergenic
980939484 4:139260208-139260230 TCTAAAAAACAGAAGAAGGAAGG + Intergenic
981076627 4:140598856-140598878 TCTGGACAGCAGAAAAAGGATGG - Intergenic
981210206 4:142094457-142094479 TCTGAAAAACAGACTAAGAATGG + Intronic
981218033 4:142194935-142194957 TCTGAAAAGAAAAATGATGCTGG + Intronic
981517089 4:145621040-145621062 TCTGAAAGGAGGACTGAGGAGGG + Intronic
982339659 4:154283888-154283910 GCTGGAAAGGATAATGAGGATGG - Intronic
982353657 4:154443789-154443811 TTTGGATAGCAGAATGGGGAGGG - Intronic
982472905 4:155815645-155815667 TCTGAACAACAGGATGTGGAAGG + Intergenic
982802069 4:159718066-159718088 TCTGAAAGGATCAATGAGGAAGG - Intergenic
982881384 4:160722115-160722137 TTTGAAAAGGAGAATGAACATGG - Intergenic
983557767 4:169073757-169073779 TATAAAAAGCAGAATGTGGCCGG + Intergenic
983633698 4:169876501-169876523 CCTTAAAAGCAGAATGGGGCCGG - Intergenic
983830267 4:172318404-172318426 TTTGAAAGGCTGAATGAGGCTGG + Intronic
984480825 4:180299052-180299074 TCTGTAAAGCAGTGTGAGAACGG + Intergenic
984624781 4:181994990-181995012 TAAGAAAAGTAGAATGAGGCTGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
985914864 5:2909619-2909641 TCTCAAAAGCAACATGGGGACGG + Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
986773887 5:10996391-10996413 TCTCAAAAGAGCAATGAGGAGGG + Intronic
987046642 5:14115238-14115260 TTACAAAAGCAGAATCAGGAAGG - Intergenic
987182173 5:15379639-15379661 TTTGAAAGGCAGAAAGAAGAAGG + Intergenic
987610829 5:20200029-20200051 TCTTCATAGCAGCATGAGGAAGG + Intronic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988005403 5:25403691-25403713 TCTGAAGAACAGAATGGGTATGG + Intergenic
988408530 5:30855704-30855726 TCTTAATAGCAGTATGAGAATGG + Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989781419 5:45269597-45269619 TCTAAATACCAGAATGAGGAGGG + Intronic
989970379 5:50517266-50517288 TCTGAAAAGAAAGAGGAGGAAGG - Intergenic
990044365 5:51410989-51411011 TCTGAACAGCAGAGAGACGAGGG + Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992345386 5:75870754-75870776 TCTTAAAAGCATAAAGAGAACGG + Intergenic
992455672 5:76913447-76913469 TCAGACAAACAGAATCAGGAAGG + Intronic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994305353 5:98196568-98196590 TCTGAGAAGGGGAATGAGAAAGG + Intergenic
994999580 5:107110352-107110374 TCTTAAAAGCTGCAGGAGGAGGG + Intergenic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995425333 5:112015055-112015077 TCTGGAGAGCAGAAGGAGGTTGG + Intergenic
995486505 5:112645278-112645300 TTTTAAAAGCAGAATGGGGCCGG + Intergenic
996137483 5:119861856-119861878 TATGAAAAGGAAAATGTGGAAGG + Intergenic
996382421 5:122875730-122875752 TCTGAAAAGCAGGAGGAGAATGG + Intronic
996805951 5:127454049-127454071 TATGAAAAGCTGAATAAAGAAGG + Intronic
996881350 5:128299950-128299972 TCAGAAAATCAGAATGACTAGGG + Intronic
996893585 5:128453716-128453738 GCTGAAATGCAGAGTGGGGAAGG + Intronic
996956582 5:129189791-129189813 TCCTAAAAGCAGCATGAGAAAGG + Intergenic
997113563 5:131101489-131101511 TTTCAAAGGCAAAATGAGGAAGG + Intergenic
997370970 5:133359740-133359762 TTTTAAAAGCTGAATGAGGGTGG - Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
998450866 5:142233606-142233628 TCTGTATAGCAGCATGAGAACGG + Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999030873 5:148289825-148289847 TCTGGGAATCAGAATTAGGATGG + Intergenic
999561512 5:152808299-152808321 ACTGAACACCAAAATGAGGATGG + Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001440895 5:171742003-171742025 TCTCAACAAAAGAATGAGGAGGG + Intergenic
1001763895 5:174229767-174229789 TCTAAACAGCAGTATGAGGAAGG - Intronic
1002029927 5:176420391-176420413 TTTTAAAGGCAAAATGAGGAAGG - Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002493708 5:179597891-179597913 TGTAGAAAGCAGAATGAGGCCGG + Intronic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1002698330 5:181104875-181104897 GCGGAAAAGCAGCATCAGGATGG + Intergenic
1002708567 5:181180033-181180055 GCGGAAAAGCAGCATCAGGATGG - Intergenic
1003025476 6:2551211-2551233 TCTGAAAAAAAGAATTAGGAGGG + Intergenic
1003461748 6:6335065-6335087 TCTGAAAAAAAAAATGAGAAAGG - Intergenic
1004148638 6:13093450-13093472 TGTGATAAGGAGAATGATGATGG - Intronic
1004947089 6:20627526-20627548 TCGGAAAAGAATAATGTGGAAGG - Intronic
1005153786 6:22780706-22780728 TCTTCCAAGCAGAAGGAGGAAGG - Intergenic
1005209030 6:23439559-23439581 TATGTAAAGTAGAATCAGGAAGG + Intergenic
1007122134 6:39391178-39391200 TCTGAAGACCAGAAGTAGGACGG + Intronic
1007363941 6:41376771-41376793 TCAGGAAAGCAGCCTGAGGAGGG + Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008550344 6:52623681-52623703 ACTGAAAAGGGGAATGAGAAAGG - Intergenic
1008554696 6:52663597-52663619 GCTGAAAAGAGGGATGAGGAAGG + Intergenic
1008817373 6:55584539-55584561 TCTCAAAAACAGAGTGAGGAGGG + Intergenic
1009672474 6:66773728-66773750 GATGACAAGCAGAATGGGGAAGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009889788 6:69666671-69666693 TCTTCACAGCAGTATGAGGATGG + Intergenic
1011378488 6:86717844-86717866 TCTTAATAGCAGTATGAGAATGG - Intergenic
1012576169 6:100802701-100802723 TATTAAAAGCAGAATCAGGCTGG + Intronic
1012638835 6:101582582-101582604 TCTTCAAAGCAGCATGAGAATGG + Intronic
1012980068 6:105819916-105819938 GCTGAAGCTCAGAATGAGGATGG + Intergenic
1013589714 6:111609799-111609821 GCTGAAAAGCAGCCTGAGGATGG + Intergenic
1013687181 6:112599199-112599221 TCTGGAAAACAAAATGAAGAGGG + Intergenic
1013705048 6:112823045-112823067 TCTGTGAAGCAGAATCAGAATGG - Intergenic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1014624697 6:123711241-123711263 TCTGATAAGCAGATTCTGGATGG - Intergenic
1015029202 6:128573902-128573924 TCTGAAAAGCAGAATGTGTCAGG - Intergenic
1016521681 6:144953644-144953666 TCAGAAAAGCTGAGTGAGGTAGG - Intergenic
1016754411 6:147668137-147668159 TCTGAAAAGGAAAATGAGGTTGG - Intronic
1017332371 6:153214793-153214815 TCTGAAAAACAGAATAATAAGGG - Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017582450 6:155881238-155881260 TCAGGAAAGTAGAATGTGGAGGG - Intergenic
1017680028 6:156854233-156854255 CCAGAAAAACAGAAAGAGGAGGG - Intronic
1017690523 6:156959577-156959599 TCTTAAAAGGAGGATCAGGAGGG + Intronic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1017869766 6:158477271-158477293 TATGAAAAGCAGAACTAGGAGGG + Intronic
1018361751 6:163077866-163077888 TATGAACAGGGGAATGAGGAAGG + Intronic
1019035192 6:169048776-169048798 TCTGCTCAGCAGAATGAGGGAGG - Intergenic
1019057279 6:169232583-169232605 TCAGAAAAGCAGCAGGAGGAAGG - Intronic
1019825951 7:3284509-3284531 TCTCAAAAACACAATGATGAAGG - Intergenic
1019973738 7:4563364-4563386 TCTGGAAAGTGGAAAGAGGAAGG + Intergenic
1020342229 7:7124473-7124495 TCTGAAAAGTAGAGGGAGGGAGG - Intergenic
1020745382 7:12072786-12072808 TCTCAACAGCAGAAAAAGGATGG + Intergenic
1020829492 7:13076163-13076185 TCTGAAAAACAGCAAGAAGAAGG - Intergenic
1021297614 7:18927834-18927856 GCTGAATGGCAGAGTGAGGATGG + Intronic
1021316823 7:19157934-19157956 TCTGATAAGCAGGAGGAGGTAGG + Intergenic
1021515821 7:21485428-21485450 TCTGGAAAGCAGGATGGGGTGGG - Intronic
1022680267 7:32538611-32538633 TCTGGAGAGGAGAATGAGGTTGG - Intronic
1023218418 7:37891699-37891721 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1024635129 7:51281244-51281266 TCTGAACAACATAAAGAGGAAGG + Intronic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1026192275 7:68140307-68140329 TCTGAGCAGCAGAGTGAGTAGGG - Intergenic
1026489150 7:70847846-70847868 TATGAACAGCAGAAAGAGGGTGG + Intergenic
1027199618 7:76055234-76055256 TTTGAAAAGTAGTATGAGGATGG + Intronic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1028123242 7:87081643-87081665 TGTGAAAAGCAGAATGAGAGAGG + Intergenic
1028814255 7:95126365-95126387 TCTGAAAACCAGAATCAATAGGG - Intronic
1028966201 7:96804461-96804483 CCTGAAAGGCAGAATTAGAAGGG - Intergenic
1029545760 7:101209835-101209857 TCTTAAAAGAAGAATGGGGCTGG - Intronic
1029736553 7:102468702-102468724 CCTGAACAGCAGCATGGGGATGG + Intronic
1029889833 7:103915898-103915920 TCTGCAGAGCAGAAAAAGGATGG + Intronic
1029910833 7:104145710-104145732 TCTGAAAGGTAGAAAGAGGTAGG + Intronic
1031323357 7:120361659-120361681 TTTGAAAAGCAGAAAGGCGAAGG + Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032722151 7:134558976-134558998 TCTGGACAACAGAAAGAGGATGG + Intronic
1033274369 7:139960020-139960042 TTTGAAAATCAGAACGAGCAGGG + Intronic
1034382926 7:150714650-150714672 TCTTTAAAGCAGCGTGAGGACGG + Intergenic
1035156671 7:156920113-156920135 TCTGAAAAGTGGAAAGAGGAAGG + Intergenic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035540715 8:435013-435035 TCTGAAAACCAGCATTGGGATGG - Intronic
1037352552 8:17976724-17976746 TGAGAAAAACAGAATGAGAAAGG + Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038035219 8:23681639-23681661 TCTGGAAAGGAGAGTGGGGAAGG + Exonic
1038055502 8:23853922-23853944 TCTGAAAATCAGTCTGAAGAGGG + Intronic
1038569166 8:28645075-28645097 TCTGAAAAGGGGAGTGAGAAAGG + Intronic
1038626425 8:29197676-29197698 GCAGAAAAGAAGGATGAGGAAGG - Intronic
1039033487 8:33333868-33333890 GCTGAAATACAGAGTGAGGAAGG + Intergenic
1039080476 8:33728958-33728980 TCAGAAAAGCAGCAAGAAGATGG - Intergenic
1041114317 8:54519911-54519933 TTTGAAAAGAAGAATCAGAAGGG + Intergenic
1042177929 8:66056076-66056098 TCTGAAAGGTAGAAAGAGAAAGG + Intronic
1042301964 8:67293567-67293589 TCTATAAAAAAGAATGAGGAAGG + Intronic
1042395457 8:68286420-68286442 TCTGAAAGGCAGTAAGAGGAAGG - Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1045139997 8:99269156-99269178 TCTTTATAGCAGCATGAGGATGG + Intronic
1045856796 8:106773493-106773515 TATGAATAGTAGAAAGAGGAAGG + Intergenic
1045857606 8:106782050-106782072 TCTGCAATGGAGACTGAGGAAGG + Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046725476 8:117669070-117669092 TCTTTAAAGCAGCATGAGAATGG + Intergenic
1047348553 8:124051712-124051734 TCTGGGGAGCATAATGAGGAAGG + Intronic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1050052636 9:1619186-1619208 ACTGAACAGCAGCATGAGGCAGG + Intergenic
1050346642 9:4695376-4695398 TCTGAGAAACAGAATGATTATGG - Intronic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1051068092 9:13129164-13129186 TCAGAAAAGCAGGATGAGGCTGG + Intronic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1051345084 9:16144149-16144171 TCAGAAAAGCAGAGTGTGGGTGG - Intergenic
1051602444 9:18888846-18888868 TCTGAAAAGCCAAATGGTGAAGG - Intronic
1052565443 9:30144071-30144093 TCTGAACAGAAGAAGAAGGAGGG - Intergenic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053573279 9:39331880-39331902 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1053624636 9:39856112-39856134 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1053880234 9:42587116-42587138 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1053892430 9:42707210-42707232 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054094849 9:60890586-60890608 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054116316 9:61166490-61166512 TCTGGATAGGAGAATGGGGAAGG + Intergenic
1054123865 9:61287131-61287153 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054219260 9:62394586-62394608 TCTGTATAGGAGAATGGGGAAGG - Intergenic
1054231454 9:62514587-62514609 TCTGTATAGGAGAATGGGGAAGG + Intergenic
1054591443 9:67016054-67016076 TCTGGATAGGAGAATGGGGAAGG - Intergenic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055114209 9:72589661-72589683 TCTCAAAATCAGAAAAAGGATGG - Intronic
1055191749 9:73532914-73532936 TGGGAAGAGCAGGATGAGGAAGG - Intergenic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1056440755 9:86618752-86618774 TCAGAAAAGAAAAATAAGGAAGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1057745495 9:97747697-97747719 GGTGAAAAGCAGAATTAGAATGG - Intergenic
1057950888 9:99368388-99368410 TCAGAAGAACAGACTGAGGATGG + Intergenic
1058273371 9:103005349-103005371 GATGAAAAGAAGGATGAGGATGG + Exonic
1058349926 9:104009471-104009493 TCTGAAAGGCACAGAGAGGAAGG - Intergenic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1058699998 9:107592027-107592049 TCTGTGAAGGAGCATGAGGAAGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059204987 9:112456230-112456252 TCTGAAAAGGAGAAAAAAGATGG - Intronic
1059932642 9:119276337-119276359 TATGAAAAGAAAAATCAGGAAGG - Intronic
1060297085 9:122350182-122350204 TCTGGATAGGAGAATGAGGATGG + Intergenic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1061439651 9:130592228-130592250 TCTCAAAAATAAAATGAGGAAGG + Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1185615752 X:1420793-1420815 TCTGAAAAATAGAAATAGGAAGG - Intronic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186311818 X:8328260-8328282 TTTGAAAAGCAGATTAATGATGG - Intergenic
1186403265 X:9279018-9279040 TCTGAAATGCTGGATGAGGAAGG + Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1187200451 X:17129243-17129265 TGTGGAAAGCAGAATAAGGTGGG - Intronic
1188581874 X:31723759-31723781 TTTGAAAAGCAGAAGGAAGCTGG - Intronic
1188774065 X:34190587-34190609 TCTTTATAGCAGAATGAGAATGG - Intergenic
1189567868 X:42261984-42262006 ACTGAAAAGAAGAATGAGTATGG - Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1191968295 X:66785567-66785589 TCTGAAAAGTGCAAAGAGGAAGG + Intergenic
1192207311 X:69105076-69105098 TCTGAAAGCCAGGATGGGGAAGG + Intergenic
1194043434 X:88971420-88971442 ACTGAATAGCAGGATGAGGTTGG - Intergenic
1194594980 X:95846862-95846884 TCTGAAAGCCAGAAAGAGCAAGG - Intergenic
1194993585 X:100570411-100570433 TGTGAACAGCAGAATGGGGGTGG - Intergenic
1195850192 X:109274450-109274472 TCTGACAAGAACGATGAGGATGG - Intergenic
1196961462 X:121007612-121007634 TAGAAAAAGCAGAATGGGGAAGG + Intergenic
1197388024 X:125825129-125825151 TCTGACAAGCAAAATGCTGAGGG - Intergenic
1198425192 X:136511402-136511424 TCTGAAAAACAGTCTGAAGATGG + Exonic
1199030106 X:142987613-142987635 TCTTTACAGCAGCATGAGGATGG + Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1200034486 X:153318981-153319003 TCAGAAAACGAGGATGAGGATGG - Intergenic
1200121120 X:153791064-153791086 TCTGAAGAGCGGAAGGAGGCAGG - Intronic
1200414778 Y:2898356-2898378 TGTGAAAAGAAGCTTGAGGATGG + Intronic
1201329795 Y:12805368-12805390 TCTGAATAGAAAAATGAGAAAGG + Intronic
1201448429 Y:14083412-14083434 TCTGAACAGCTGACTGAGCAAGG + Intergenic
1201464392 Y:14264476-14264498 TCAGAAAAGAAGAATTGGGATGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1201968368 Y:19763410-19763432 TCTGAAAGGCAGGAGCAGGATGG + Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic