ID: 1087740459

View in Genome Browser
Species Human (GRCh38)
Location 11:101881297-101881319
Sequence CCAACCACGAAGAAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087740451_1087740459 29 Left 1087740451 11:101881245-101881267 CCAGAAACAAAGTAGGAGATCTG No data
Right 1087740459 11:101881297-101881319 CCAACCACGAAGAAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087740459 Original CRISPR CCAACCACGAAGAAGTTGGA GGG Intergenic
No off target data available for this crispr