ID: 1087741439

View in Genome Browser
Species Human (GRCh38)
Location 11:101892089-101892111
Sequence GAATTTTTCTTGAGGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087741439_1087741445 30 Left 1087741439 11:101892089-101892111 CCAAATGCCCTCAAGAAAAATTC 0: 1
1: 0
2: 2
3: 21
4: 307
Right 1087741445 11:101892142-101892164 ACGGCTCTTCACATGATTTATGG 0: 1
1: 0
2: 0
3: 5
4: 41
1087741439_1087741442 -7 Left 1087741439 11:101892089-101892111 CCAAATGCCCTCAAGAAAAATTC 0: 1
1: 0
2: 2
3: 21
4: 307
Right 1087741442 11:101892105-101892127 AAAATTCAGATATACTGTTGAGG 0: 1
1: 0
2: 2
3: 18
4: 304
1087741439_1087741443 11 Left 1087741439 11:101892089-101892111 CCAAATGCCCTCAAGAAAAATTC 0: 1
1: 0
2: 2
3: 21
4: 307
Right 1087741443 11:101892123-101892145 TGAGGTGTACCTTTTCTTCACGG 0: 1
1: 0
2: 2
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087741439 Original CRISPR GAATTTTTCTTGAGGGCATT TGG (reversed) Intronic
907355871 1:53873499-53873521 GAATTTATCTTGAGGGCAACAGG + Intronic
907433573 1:54429511-54429533 GACTTTATCTTGAGAGCAATGGG + Intergenic
907575337 1:55521263-55521285 GGCTTTTTCTTGAGGCCACTAGG - Intergenic
907622729 1:55998005-55998027 GAACTATTCCTGAGGGGATTAGG + Intergenic
907752990 1:57281602-57281624 GACTTTTTCCTGAGGGCAGGAGG + Intronic
908140378 1:61178431-61178453 GAATTGTTTTTTAAGGCATTTGG - Intronic
908206119 1:61851593-61851615 GACTTTATCTTGAAGGCAGTAGG + Intronic
909235332 1:73146292-73146314 GTATTTTTCTGGAAGGCATGGGG - Intergenic
909307416 1:74098929-74098951 TACTTTGTCTTGTGGGCATTTGG - Intronic
910678130 1:89835234-89835256 GAAGGGTTCTAGAGGGCATTGGG + Intronic
910695060 1:90003598-90003620 AAAGTTTTCTTGAATGCATTAGG + Intronic
910757508 1:90708079-90708101 GAATCTTTGGTGAGGGAATTCGG - Intergenic
912445192 1:109730479-109730501 TAAAGTTCCTTGAGGGCATTAGG + Intronic
912668593 1:111605350-111605372 GAATATTTTTTGAGACCATTAGG - Intronic
913339493 1:117744503-117744525 GACTTTTTCATGTAGGCATTTGG + Intergenic
915072469 1:153282083-153282105 TGCTTTTTCTTGTGGGCATTTGG + Intergenic
916332454 1:163632751-163632773 GAATTTTTCTGGAGATCCTTGGG + Intergenic
918397047 1:184123838-184123860 GATTTTTTTTTGAGGGTATGTGG - Intergenic
918405233 1:184205753-184205775 GCCTTTTTCCTGAGGACATTAGG + Intergenic
918802975 1:188997327-188997349 GAATTTTTCTTGAACGCAGGAGG - Intergenic
920247688 1:204600737-204600759 GCATTTTTTTTGAGGGGAGTGGG + Intergenic
921232034 1:213082898-213082920 TAATCTTTATTGAGAGCATTTGG - Intronic
921678171 1:218000551-218000573 GACTTTTCCTTGAGGAAATTTGG - Intergenic
1062764791 10:52952-52974 GCATTTTGTTTGATGGCATTTGG + Intergenic
1064158185 10:12921034-12921056 GCATTTTTCTTGAGAGTAGTTGG - Intronic
1065623600 10:27608607-27608629 GTATTTTTCTAAAGGGGATTTGG - Intergenic
1065869708 10:29945951-29945973 GGCTTTATCTTGTGGGCATTGGG - Intergenic
1067753985 10:48990521-48990543 TAATTTTTCTTGATGGCATGAGG - Intergenic
1068515369 10:58019398-58019420 GAATTGTGCTTGATGTCATTAGG + Intergenic
1068826138 10:61441524-61441546 GTCTTTGTCTTGATGGCATTAGG + Intronic
1070372228 10:75793237-75793259 GAGTTTTTCTTGAGGACAGGAGG + Intronic
1071798762 10:89034366-89034388 GATTCTTTCTTGATGGCATTTGG + Intergenic
1072504959 10:96056490-96056512 GCATTTTTTTTTAGGGGATTGGG + Intronic
1072951705 10:99852616-99852638 GAATTCTTCCTAAGGGAATTGGG + Intergenic
1074184211 10:111086983-111087005 GATTTTATCTTGAGGGCATGGGG + Intergenic
1074338424 10:112601814-112601836 TAATTTTTCTGAAGGGCATTGGG + Intronic
1074855743 10:117472127-117472149 GACTTTTTTCTGAGGGCAATGGG + Intergenic
1075160082 10:120015996-120016018 AAATCTTTCGTAAGGGCATTAGG + Intergenic
1076549459 10:131268404-131268426 GCATCGTTCTTGAGGGCCTTAGG + Intronic
1079110598 11:17603041-17603063 GACTTTATCCTGAGGGCAATGGG + Intronic
1079126953 11:17723886-17723908 GACTTTATCTCGAGGGCAGTAGG + Intergenic
1079573716 11:21976730-21976752 AAACCATTCTTGAGGGCATTTGG + Intergenic
1080732675 11:34975760-34975782 TAACTTTTCTTGAGCTCATTAGG - Intronic
1080995282 11:37592256-37592278 GTATTTTTCATCAGGGCTTTGGG + Intergenic
1081981303 11:47269001-47269023 GAATTTTTCTTGGGGCCCTGTGG - Intronic
1082761784 11:57133945-57133967 GCATATTTCTTAAGGGCCTTAGG + Intergenic
1082984192 11:59153271-59153293 GAATTTTTCTTTGGGGCTTCCGG + Exonic
1083829238 11:65220846-65220868 GAATTTATCTGGAGTGCAGTAGG + Intergenic
1085252665 11:75153800-75153822 GACTTTTTCTTAAAGGCAATTGG + Intronic
1085730600 11:78995315-78995337 GATTTTGTCCTGAGGGCAATGGG + Intronic
1085898175 11:80664448-80664470 GACTTTATCTTGAGAGCACTGGG + Intergenic
1085922071 11:80969254-80969276 GAGTTTTACATGAAGGCATTGGG + Intergenic
1086324240 11:85682402-85682424 AAATTTTTCGAAAGGGCATTAGG + Intronic
1087430914 11:98053962-98053984 GAATTTTTCTTCTGAGCTTTGGG - Intergenic
1087741439 11:101892089-101892111 GAATTTTTCTTGAGGGCATTTGG - Intronic
1087773616 11:102237704-102237726 GAATTTTTCTTCAGTGATTTTGG - Intergenic
1092374142 12:7941369-7941391 AAATTTTTCTTCTGGGCATGGGG + Intergenic
1092698486 12:11200801-11200823 GACTTTTTGTTTAGGGCAGTTGG + Intergenic
1093704456 12:22259262-22259284 GACTTTTGTTTGAGGGCTTTGGG - Intronic
1094022869 12:25932768-25932790 GAATTTATCTTGACTTCATTCGG + Intergenic
1095171124 12:39037629-39037651 GAATTTCCCTTGAAGGAATTCGG - Intergenic
1096767357 12:53903365-53903387 TAATTTTTCTACAGGGCCTTAGG - Intergenic
1097132049 12:56818924-56818946 GTATCTTTCCTGAGGGAATTGGG + Intergenic
1098248912 12:68548293-68548315 GAATTTCTTTTTAGGGCAGTGGG + Intergenic
1099738538 12:86601299-86601321 GAATTTTTTTTGATAGCTTTTGG + Intronic
1100102566 12:91126649-91126671 GAATTTTGCTTGTGGGTATGTGG + Intergenic
1100331021 12:93582314-93582336 GAATTTATCCTGAGGGCAGTAGG + Intronic
1100756405 12:97755969-97755991 GAATATTTCACAAGGGCATTTGG + Intergenic
1100777870 12:97992120-97992142 GATTTTGTCTTTAGGGCAATGGG - Intergenic
1100946937 12:99795760-99795782 GAATTCTGATTGATGGCATTCGG - Intronic
1103257444 12:119554207-119554229 GAATTTGTCTTGAGAGTAATAGG + Intergenic
1103499242 12:121388130-121388152 GACTTTTTCATGAGGCCATTGGG + Intronic
1104046378 12:125166018-125166040 GAATTTTCACTGAGGGCATCGGG + Intergenic
1104083393 12:125453199-125453221 GAATTTTAAATGAGAGCATTTGG + Intronic
1105353916 13:19640490-19640512 CATTTTTTCTGGAAGGCATTTGG + Intronic
1106268950 13:28135931-28135953 AACTTTTTCTTGAGGACAATTGG - Intergenic
1107706107 13:43107641-43107663 CAATTTTTTTTTAGGGAATTTGG + Exonic
1108097287 13:46916670-46916692 GAATTTTTGTTGATGCCATGAGG + Intergenic
1108578026 13:51805733-51805755 GAAATTTCCATGAGGGCATGAGG + Intergenic
1110025290 13:70530172-70530194 CAATTTCTATTGACGGCATTTGG - Intergenic
1110792153 13:79598487-79598509 GATTTTATCCTAAGGGCATTGGG - Intergenic
1112179237 13:97061295-97061317 GACTTTTTCTTCATGTCATTTGG - Intergenic
1114803098 14:25800858-25800880 GAATCTTTCTTGAGGTCTGTAGG + Intergenic
1115263526 14:31477322-31477344 GACTTTATCTTGAGGGCATTTGG - Intergenic
1116184917 14:41587470-41587492 CAAGATTTCTTGAGAGCATTTGG + Intergenic
1116826591 14:49678610-49678632 GAATTTCTATTGATGGCTTTAGG + Intronic
1117013142 14:51491155-51491177 GAATGTTTGTTGAGGGCCTAGGG - Intronic
1117596679 14:57332873-57332895 GAATTTATCTTGAAGGCTTATGG - Intergenic
1119134803 14:72207514-72207536 AAATTTATCTTGAGGGCAATGGG - Intronic
1120318583 14:82929760-82929782 GTATTATTCTTGAGGGCCCTAGG + Intergenic
1120378189 14:83736527-83736549 GGAGTTTTCTTTAGGGCATCTGG + Intergenic
1120455999 14:84731317-84731339 GAATGTTTCTGGAGGAGATTTGG + Intergenic
1120947318 14:90010696-90010718 GAATTCTTCCTGAGGGCCTCTGG + Intronic
1124971408 15:34493256-34493278 GAATTTTTCTCTGGGGCACTTGG + Intergenic
1126033648 15:44526097-44526119 GTATTTATCTTTAGGGCATCTGG + Exonic
1126394828 15:48203724-48203746 GAATTTTTCTTTAGTGGATTTGG - Exonic
1127567919 15:60211553-60211575 GAAGGTTTCTTGAGGGAATGTGG - Intergenic
1129368600 15:75072852-75072874 GAATTTTTCTTAAGGCCATATGG + Intronic
1129708868 15:77810029-77810051 GGCTTATTCTTGAGGTCATTGGG - Intronic
1130720518 15:86381909-86381931 GATTTTATCTTGAGGCCAATGGG + Intronic
1131633317 15:94202981-94203003 TAATTTTTGTTAAGGGTATTAGG - Intergenic
1131756061 15:95563921-95563943 GATTTTATCCTGAGGGCACTAGG + Intergenic
1132032346 15:98448750-98448772 GCATAATTCTTGAGGGCCTTAGG + Intronic
1133820088 16:9228216-9228238 GACTTTATCCTGAGGGCAATGGG + Intergenic
1134296903 16:12954351-12954373 GATTTTATCTTGAGGGCCATGGG + Intronic
1135551420 16:23401001-23401023 GAATGTCACTTGAGGGCAATAGG + Intronic
1135841710 16:25882795-25882817 TAATTATTCTTGTGGGCATCTGG - Intronic
1138253502 16:55528954-55528976 GAATTTATCTTCAGGATATTAGG + Intronic
1138546729 16:57723979-57724001 GAACTTTTCTGGAGGACAGTTGG + Intronic
1142439858 16:90090266-90090288 GCATTTTATTTGATGGCATTTGG - Intronic
1143423958 17:6818195-6818217 AAATTTATCTTGAAGCCATTGGG + Intronic
1143890688 17:10099941-10099963 GAATATTTCTTGAACCCATTAGG - Intronic
1144267317 17:13583542-13583564 GCATTTTTCTGGAGGGGATGAGG - Intronic
1147847067 17:43411944-43411966 GAACATTATTTGAGGGCATTTGG + Intergenic
1148090530 17:45020297-45020319 GAAATTTTCTTGAGGGCCAGAGG + Intergenic
1148108245 17:45130770-45130792 GACTTTATCTGGAGGGCATCAGG - Intronic
1148662656 17:49347705-49347727 CAATTTTTCTTGCAGGCATGGGG - Intronic
1148968356 17:51456913-51456935 GCATTTCTCTTGAAGGCAGTGGG - Intergenic
1149099971 17:52893898-52893920 GTGTTCTTCTTGAGGGCACTTGG + Intronic
1151120185 17:71784297-71784319 GGATTTTTCTGGAGGGCTTGAGG - Intergenic
1152957697 18:53288-53310 GCATTTTATTTGATGGCATTTGG + Intronic
1153568062 18:6440022-6440044 GAATTTTTATTTAGGTTATTGGG + Intergenic
1156832592 18:41512511-41512533 GAAATTTTCTTTAGGCTATTTGG + Intergenic
1158749930 18:60246882-60246904 CAACTTTTCTTAAGAGCATTTGG + Intergenic
1160741393 19:687760-687782 GGTTTTGTCTTGAGGGCAATCGG - Intronic
1161204072 19:3031403-3031425 GGATTTATTTTGAGGGCAATAGG - Intronic
1161205534 19:3039292-3039314 GATTTTATGTTGAGGGCAATAGG - Intronic
1161242575 19:3230597-3230619 GACTCTTTCCTGAGGGCACTGGG + Intronic
1161641371 19:5425475-5425497 GACTTTCTCTTGAGGGCACTGGG - Intergenic
1161761364 19:6175276-6175298 GAATTTTTCTTGAATGAATGAGG - Intronic
1163447010 19:17352841-17352863 GACTTTCTCCTGAGGGCACTGGG - Intronic
1165107112 19:33477036-33477058 GACTTTTTCTTGAGAGGAATGGG - Intronic
1165143437 19:33716698-33716720 GAGCTTTTCTTCAGGGTATTCGG + Intronic
1165255437 19:34575120-34575142 GAATCTTCCCTGAGGGCATCAGG - Intergenic
1166007500 19:39917459-39917481 GACTTTATCTAGAGGGCAATGGG + Intronic
1166549742 19:43657314-43657336 GAATTTATTTTCAGGGCAGTAGG - Intronic
1166804475 19:45477170-45477192 GATCTTTTCTTCAGGGCACTGGG + Intronic
1167077698 19:47259295-47259317 GACTTTGTCCTGAGGGCACTGGG + Intronic
1167162276 19:47775985-47776007 GAGTTTTTGTTGAGGGCTCTGGG + Intergenic
1167711397 19:51113512-51113534 GACTTTATATTGAGGGCACTGGG - Intergenic
1168505183 19:56928163-56928185 GAATTTATCCTAAGGGCAATAGG + Intergenic
926487146 2:13475861-13475883 TAATGTTTCATGAGGGGATTTGG + Intergenic
926915020 2:17882957-17882979 GTATTTTTCTTGTGGGCAAGAGG + Intronic
930566533 2:53027892-53027914 GACATTATCTTGAGGACATTAGG - Intergenic
932007059 2:67937758-67937780 GAAGTATTCTTGAGGGCTCTTGG - Intergenic
932573232 2:72949255-72949277 GCATTTTACCTGAGGGCAATAGG + Intronic
933016827 2:77138496-77138518 TGCTTTTTCTTGTGGGCATTTGG - Intronic
933136782 2:78746093-78746115 AAATTTTTCTTAAGGAAATTAGG - Intergenic
935011954 2:99143929-99143951 GATTTTTTTTTGAGGGGATCAGG - Intronic
935387907 2:102520655-102520677 GAATTCATTTTGAGGGCCTTTGG + Intronic
935861850 2:107339734-107339756 GGATTTTTCCCAAGGGCATTTGG + Intergenic
937417901 2:121731562-121731584 GAATTTATCCTGAGGGCAGTGGG - Intronic
937926351 2:127170637-127170659 GAATTTATCCTGAGGGCACTGGG + Intergenic
938004562 2:127777928-127777950 GAAGTTATCTTGTGAGCATTTGG - Intronic
938192828 2:129299348-129299370 GAGTTTCTCTTTAGGGCAATAGG - Intergenic
940620260 2:156103665-156103687 TAATTTTTGTTGAGGGTATAAGG - Intergenic
941364652 2:164595432-164595454 TTGTTTTTCTTGAGGACATTAGG + Intronic
941551821 2:166926140-166926162 GAATCTTGCTTGAGGTTATTTGG + Intronic
943048182 2:182883497-182883519 GACTTTTTCTAGTGGGCACTGGG - Intergenic
943241038 2:185384337-185384359 GAATTAACCTTTAGGGCATTAGG - Intergenic
943290618 2:186066664-186066686 TTATTTTTCTTTATGGCATTAGG - Intergenic
943923761 2:193744296-193744318 AACTTTTTCATGTGGGCATTTGG - Intergenic
944224929 2:197340082-197340104 GAATTGTTCATGAGAGCAATAGG + Intergenic
944799289 2:203221804-203221826 GTATTTTTCTTGATGACCTTAGG + Intronic
945020957 2:205571138-205571160 GTATTTTATTTGAGGACATTTGG - Intronic
946772990 2:223108508-223108530 GAATCTTTCCTGGGGCCATTTGG - Intronic
947037843 2:225879673-225879695 GAATATTACAGGAGGGCATTTGG + Intergenic
948470474 2:238174336-238174358 GAATTGTTCTTTGGGGCAGTAGG - Intronic
1169582529 20:7040212-7040234 GACTTTTAATGGAGGGCATTTGG - Intergenic
1169808665 20:9585757-9585779 GTGTTTTCGTTGAGGGCATTAGG - Intronic
1169827819 20:9789307-9789329 GAATTTTTCTTGGGGACAGATGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171818167 20:29807354-29807376 GCATTTTGTTTGATGGCATTTGG + Intergenic
1171899631 20:30845643-30845665 GCATTTTGTTTGATGGCATTTGG - Intergenic
1172374028 20:34421473-34421495 CAAATTTTCTTGAGGAAATTTGG + Intronic
1172436221 20:34930714-34930736 GATTTTATCTTAAGGGCAGTGGG - Intronic
1172902585 20:38345955-38345977 GAAATTTTCTGGAAGGCAATTGG - Intergenic
1173005321 20:39135646-39135668 GAATTTGTCTTGAGGGGTTGTGG + Intergenic
1174321048 20:49741920-49741942 GATTTTTTCCTGAGGGCAATGGG - Intergenic
1174726646 20:52869546-52869568 GACTTTATCTTGAGGGTACTAGG + Intergenic
1176732457 21:10513363-10513385 AAGTTTATTTTGAGGGCATTGGG + Intergenic
1178118212 21:29439188-29439210 CAGTTTTACTTTAGGGCATTAGG - Intronic
1179044771 21:37834202-37834224 GAATTTTTCCTGTGGGTAATGGG - Intronic
1180321608 22:11326773-11326795 GCATTTTGTTTGATGGCATTTGG + Intergenic
1180333443 22:11553918-11553940 GCATTTTGTTTGATGGCATTTGG - Intergenic
1182950325 22:34368766-34368788 AAATTTTTGATGTGGGCATTTGG + Intergenic
950081930 3:10228797-10228819 CAGTGTTTCCTGAGGGCATTTGG + Intronic
951006717 3:17625130-17625152 GAATTTATCTTCATAGCATTTGG + Intronic
951102339 3:18703515-18703537 GAATTATCCTTCAGGGCAGTGGG - Intergenic
951269184 3:20603774-20603796 GAATTTTTCCTGTGGGCAATGGG + Intergenic
951994675 3:28714049-28714071 AAACTTGTTTTGAGGGCATTGGG + Intergenic
952890683 3:38038284-38038306 GACTTTATTTTGAGGGCAGTAGG - Intergenic
954098688 3:48352773-48352795 GATTTTTGCCTGTGGGCATTTGG + Intergenic
954245981 3:49331729-49331751 GCATAATTCTTGAGGGCCTTGGG + Intronic
954986784 3:54801380-54801402 CAACTTTTCTTGAGAGTATTTGG + Intronic
956817833 3:72924506-72924528 GTCTTTTTCTTAAGGGCAGTGGG + Intronic
957301673 3:78399337-78399359 GAATTTTTGTGGAGGGTTTTGGG + Intergenic
957801911 3:85095797-85095819 GAAATTTTCTTGAGCACATCTGG + Intronic
958082540 3:88765065-88765087 AACTTTTTCATGTGGGCATTTGG + Intergenic
958578542 3:95985949-95985971 AAATATTGCTTGAGAGCATTAGG + Intergenic
958617015 3:96506967-96506989 GAATTTGTCTGGTGGTCATTTGG + Intergenic
958799531 3:98739222-98739244 GAATTTTTGATGTAGGCATTTGG - Intronic
959682038 3:109106895-109106917 GATTTTATCCTGAGAGCATTGGG - Intronic
959801283 3:110498053-110498075 CACTTTTTCCTGTGGGCATTTGG - Intergenic
960824583 3:121769048-121769070 CAATCTTTCTTGTGAGCATTTGG + Intergenic
962326866 3:134441661-134441683 AAAATTTTCTTGAGGTGATTTGG + Intergenic
963754736 3:149223395-149223417 GTATCTTACTTGAGGTCATTTGG - Intergenic
964069949 3:152619427-152619449 GAATTTATTCTGAGGGCAATGGG + Intergenic
964878535 3:161397463-161397485 AACTTTTTGATGAGGGCATTGGG - Intergenic
965091582 3:164169917-164169939 GACTTTATCTTGAAGGCAGTGGG - Intergenic
965256503 3:166420468-166420490 GAATTTCTAGTGAGGGAATTAGG - Intergenic
965541211 3:169872962-169872984 GAATGAATCTTGAGGACATTAGG + Intergenic
967962025 3:194933229-194933251 CAATCTTTCTTGAGAGCATGGGG - Intergenic
968286987 3:197514532-197514554 GAAAGTTTCTTGAGAGCACTGGG - Intronic
968357036 3:198116896-198116918 GCATTTTGTTTGATGGCATTTGG - Intergenic
969051945 4:4379441-4379463 GAATGTGGGTTGAGGGCATTGGG + Intronic
970124056 4:12789607-12789629 GAAGTTTTCATGAGGAGATTGGG + Intergenic
972039926 4:34580443-34580465 AAATTTTTCTTAAGGCCATGTGG + Intergenic
972422718 4:38904682-38904704 GAATGTTTCTTTAAAGCATTAGG - Intronic
973206996 4:47571969-47571991 GAATTCTTCCTGATGGCAGTGGG + Intronic
973584525 4:52377182-52377204 TAATTTTTCTTTAGGGGCTTTGG - Intergenic
973836952 4:54819277-54819299 GAATTATTCCAGAGGACATTTGG - Intergenic
975237777 4:72020425-72020447 GATTTTTTCTTGAGGGCAACAGG - Intergenic
975605413 4:76149375-76149397 GACTATTTCTTGAGGGTAATGGG + Intergenic
977837451 4:101662095-101662117 GTATTTATCTTGAGGAAATTTGG + Intronic
977851044 4:101829926-101829948 GAATTTCTCTTTTCGGCATTTGG + Exonic
979337628 4:119481708-119481730 AAATTTTTCTTGAGGGCTTAGGG + Intergenic
980719954 4:136682667-136682689 GAATTTTTCTTGAAGGTCCTTGG - Intergenic
981644162 4:146979506-146979528 GAAATTTTCATGTGGGCTTTGGG - Intergenic
981881952 4:149624786-149624808 GACTATTTCTTAAGAGCATTTGG - Intergenic
982387212 4:154821947-154821969 AAATTTTTCTTGAGATTATTTGG + Intronic
988338269 5:29935049-29935071 GATTTTTTCAGGAAGGCATTTGG + Intergenic
989305447 5:39950036-39950058 AAATTTTTCTGTAAGGCATTAGG - Intergenic
991631419 5:68660326-68660348 GAATTTATCCTGAGGACAATAGG - Intergenic
992074623 5:73179838-73179860 GCATTATTCTTAAGGGCCTTGGG - Intergenic
992424873 5:76646714-76646736 GGTTTTTTTTTGAGGGCAATTGG + Intronic
993409851 5:87559779-87559801 GAATTTTTCTTGAAGGGAAAGGG + Intergenic
993634074 5:90323336-90323358 GACTTTTTGATGTGGGCATTTGG + Intergenic
993673840 5:90794653-90794675 CTATTGTTCTTGATGGCATTGGG - Intronic
995763949 5:115595624-115595646 GAGTTTTTCTTGAAGGCATTAGG - Intronic
997052627 5:130400323-130400345 GAATTGTTCTCCAGGGCTTTTGG - Intergenic
999227720 5:150040929-150040951 GAATTTTCAGTGATGGCATTTGG + Intronic
999762811 5:154715668-154715690 GAATATTTTTTGAGTGCCTTGGG + Intronic
1002143687 5:177161624-177161646 GAATTTTTCCTGTGAACATTGGG + Intronic
1004326653 6:14680945-14680967 CACTTTTTCTTGTGAGCATTGGG - Intergenic
1005906359 6:30264291-30264313 GAATTTGTCATGAGGGTATCTGG + Intergenic
1005969278 6:30748826-30748848 GAAAATTTCTCTAGGGCATTAGG + Intergenic
1007415061 6:41686821-41686843 AAAGTTTTCTTAAGGCCATTGGG - Intronic
1007481471 6:42153197-42153219 GAATTTATCTTGAAGGCTTATGG - Intergenic
1008232320 6:48997422-48997444 AAATTTTTTTTGAGGGAACTAGG + Intergenic
1008386137 6:50892850-50892872 GAACTTTGCTTGAGAGCATAGGG + Intergenic
1012788742 6:103664246-103664268 GAATATATCTTTAGGGAATTAGG - Intergenic
1013066467 6:106688957-106688979 GAATTTTTATGAAGGACATTTGG + Intergenic
1013452493 6:110298221-110298243 GAATTTCTCCTGAGTGCAGTTGG - Intronic
1014583066 6:123162067-123162089 GACTTTTCCTTCAGGGCAGTGGG - Intergenic
1014851489 6:126344448-126344470 GAATTTATCCTGAGGGTATCTGG + Intronic
1015475334 6:133654095-133654117 GAGTTTTTCTTGTGGGTTTTGGG + Intergenic
1015906620 6:138123582-138123604 ACATTTCTCTTGAGGGCAGTGGG - Intergenic
1017199534 6:151737339-151737361 CAATGTTTCTTGAGGACAATTGG - Intronic
1017482714 6:154873266-154873288 GCATTTTAATTTAGGGCATTTGG + Intronic
1018284668 6:162224666-162224688 GAATCTATCTTGAGGGAAGTAGG + Intronic
1020775403 7:12448056-12448078 GGATTTCTCTTGAGGGCACCAGG + Intergenic
1021802973 7:24326170-24326192 GAAGTTTTACTGAGGGCACTAGG - Intergenic
1022551815 7:31247840-31247862 TAATTGTTCTTGAAGGCAATGGG + Intergenic
1023366320 7:39466935-39466957 GAGCTTTTCTTGATGGAATTTGG - Intronic
1024359304 7:48451809-48451831 GAATTTTTCTTTTGGTCACTTGG - Intronic
1025306282 7:57861591-57861613 AAATTTTTCTTGTCAGCATTTGG - Intergenic
1028339065 7:89695301-89695323 GACTTACTCTTCAGGGCATTGGG - Intergenic
1028989011 7:97029681-97029703 ACATTTTTCTTGAGGGCAAGGGG - Intergenic
1030000364 7:105053179-105053201 GAAATTTTTTTAAAGGCATTAGG + Intronic
1032204276 7:129848099-129848121 GAATTTTGATTGAGGGCAAGAGG - Intronic
1032429294 7:131847905-131847927 GTATTTTTCTTGTAGGCAGTGGG + Intergenic
1033647597 7:143317215-143317237 GAATTTGTCTAGAGGGCAGTTGG + Intronic
1033673500 7:143515086-143515108 ACATTTTTCTTGAGGACATGTGG + Intergenic
1034049385 7:147966258-147966280 GAATTTTTATTTTGGGGATTTGG - Intronic
1034597131 7:152208165-152208187 AAGTTTATTTTGAGGGCATTGGG - Intronic
1039192414 8:34991622-34991644 GCATAATTCTTGAGGGCCTTAGG - Intergenic
1039206983 8:35167565-35167587 GATTATTTATTGAGGGCATGTGG - Intergenic
1039321691 8:36438763-36438785 GACTTTTTCTTGTGAGAATTTGG - Intergenic
1041555924 8:59155824-59155846 GAATTTTTCTAGAAGAAATTTGG + Intergenic
1042179827 8:66076033-66076055 GAAATTTTCTTGTGGGCATAAGG - Intronic
1042517427 8:69674263-69674285 AAATTTTTATTGAGGTCTTTGGG - Intronic
1043615911 8:82125104-82125126 GAAATTTTCTGGAGAGAATTAGG + Intergenic
1044521912 8:93208613-93208635 GAGGTCTTCTTGAGGGTATTGGG + Intergenic
1044756272 8:95465206-95465228 GAATTTCTCATGAGGACAATGGG + Intergenic
1045184876 8:99827699-99827721 CACTTTTTCCTGTGGGCATTTGG + Intronic
1046695678 8:117336738-117336760 GGAATTTTCTTGACAGCATTTGG + Intergenic
1047607780 8:126491772-126491794 GAATTTTTGTAGAAGGGATTGGG + Intergenic
1048287563 8:133153682-133153704 GAATATTTGTTGAGTACATTAGG + Intergenic
1049062205 8:140285500-140285522 GGCTTTCTCTGGAGGGCATTGGG - Intronic
1050285635 9:4099027-4099049 CACTTTGTCTTGAGGGCAGTGGG - Intronic
1050792603 9:9493184-9493206 GCATTATTCTTAAGGGCCTTAGG - Intronic
1051466160 9:17380379-17380401 GCATTTTTATTGGGGGCCTTTGG - Intronic
1054905251 9:70408735-70408757 GAATTTTGCTTAAAGGCATGAGG - Intronic
1055395059 9:75865387-75865409 GCATATTCCTTGAGGCCATTAGG + Intergenic
1055662574 9:78519972-78519994 GAATTTGTCCTCAGGGCATGTGG - Intergenic
1058238724 9:102528254-102528276 GAATTTTGTTTGAGGGTCTTTGG + Intergenic
1059963879 9:119594343-119594365 GAAGTTTTCTTGGATGCATTGGG - Intergenic
1060680792 9:125562207-125562229 GAATTTGTTTTGAGAGGATTTGG - Intronic
1060994568 9:127868703-127868725 GACTTTCTCCTGAGGGCACTGGG - Intronic
1061098130 9:128471937-128471959 GCATTTGCATTGAGGGCATTTGG + Intronic
1061988051 9:134141848-134141870 GAAGATTTCCTGAGGGCAATGGG + Intronic
1062740449 9:138171307-138171329 GCATTTTGTTTGACGGCATTTGG - Intergenic
1186344090 X:8673492-8673514 TACATTTTTTTGAGGGCATTTGG - Intronic
1186585107 X:10865156-10865178 GAATCTACCTTTAGGGCATTTGG - Intergenic
1186791028 X:12998900-12998922 AAATTTTTTTAGAGGGCAGTAGG + Intergenic
1187320804 X:18236028-18236050 GAATTTGTCTTTAGTGGATTTGG - Intergenic
1187542303 X:20208727-20208749 GAATTTTCCTTGGTGGCTTTGGG + Intronic
1188068899 X:25695379-25695401 GTCTTTTTCTTCAAGGCATTGGG + Intergenic
1189124504 X:38431989-38432011 GAATTTTTCCTGCAGGCACTGGG + Intronic
1190546630 X:51534686-51534708 TACTTTCTCTTGTGGGCATTTGG + Intergenic
1192478677 X:71466176-71466198 GAATTTTGGTTGGGGGGATTGGG + Intronic
1193028914 X:76876880-76876902 GCCTTTTACTTGGGGGCATTTGG - Intergenic
1193167018 X:78292945-78292967 GTCCTTTTATTGAGGGCATTTGG + Intronic
1193645322 X:84061165-84061187 TAAGTTTTCTTGTGGGCCTTAGG + Intronic
1193838630 X:86379168-86379190 GAATTTTGCTAGATGGAATTGGG - Intronic
1193838911 X:86384146-86384168 GAATTTCTCTGGAGGGCACAGGG + Intronic
1194099934 X:89691382-89691404 AACTTTTTGATGAGGGCATTTGG + Intergenic
1194263294 X:91724810-91724832 GAATCTTTCTGGAGGGAATAAGG - Intergenic
1194355346 X:92876182-92876204 GGATTTTTCTTTAGGAGATTTGG - Intergenic
1195538872 X:106039724-106039746 GACTTTACCTTGAGGGCACTGGG + Intergenic
1195617217 X:106921820-106921842 GAATTTGTCTTCTGGGCATAGGG - Intronic
1197873269 X:131080081-131080103 GACTTTTTCCTGAAGGCAATAGG - Intronic
1198376395 X:136044326-136044348 GACTTTATCCTGAGGGCAGTGGG + Intronic
1198573424 X:137983520-137983542 GAGGCTTTCTTGAGGGCACTGGG + Intergenic
1199049851 X:143224272-143224294 GAATTTTTCCTGGGGACAGTGGG + Intergenic
1199687652 X:150279044-150279066 GAATTTATCTTGAGGACAATGGG + Intergenic
1200452935 Y:3352739-3352761 AACTTTTTGATGAGGGCATTTGG + Intergenic
1200663703 Y:5993207-5993229 GGATTTTTCTTTAGGAGATTTGG - Intergenic
1201249533 Y:12042381-12042403 TGCTTTTTCTTGTGGGCATTTGG - Intergenic
1202042549 Y:20700251-20700273 GAATTTTTCTTGATGCAATTTGG + Intergenic