ID: 1087748498

View in Genome Browser
Species Human (GRCh38)
Location 11:101978368-101978390
Sequence AACGAATTGCTGAAACTAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087748498 Original CRISPR AACGAATTGCTGAAACTAAG CGG Exonic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
906755253 1:48306992-48307014 AAGGAATGGCTGAAAATAAAAGG - Intronic
910366380 1:86469754-86469776 AACAAACAGCTAAAACTAAGAGG + Intronic
910488523 1:87742671-87742693 ATCGAATGGCTGGGACTAAGGGG + Intergenic
911767769 1:101699954-101699976 CACTAATTGCTGAAACAAGGAGG - Intergenic
1067725075 10:48763935-48763957 AAGGAAATGCTGAAACAAAACGG + Intronic
1067904758 10:50279196-50279218 ACTGAATTGGTGAAGCTAAGTGG - Intergenic
1070730008 10:78820273-78820295 AAAGAATGGCTGAAACTGGGTGG + Intergenic
1071092461 10:81934927-81934949 AATTAACTGCTGACACTAAGAGG + Intronic
1071440600 10:85688999-85689021 AACAAAGTGCTAAAACCAAGAGG - Intronic
1077277644 11:1721909-1721931 AACGAATTCCTCAAACAAACTGG + Intergenic
1087748498 11:101978368-101978390 AACGAATTGCTGAAACTAAGCGG + Exonic
1087884945 11:103468999-103469021 CACACATTGCTGAAAATAAGAGG - Intronic
1088724643 11:112623253-112623275 AAAGAAGTACTGAAACTCAGAGG + Intergenic
1091198915 11:133755821-133755843 AACAAATTGTTGAACCTAAATGG - Intergenic
1091799831 12:3317835-3317857 AACTAATTTCTGAAAATGAGGGG - Intergenic
1094670752 12:32566540-32566562 AAAGAATAGCAGAAACAAAGGGG - Intronic
1095733561 12:45532494-45532516 AACGAATTGCTAAAGTTTAGGGG - Intergenic
1097735584 12:63177682-63177704 AAAGAGTTGATGAAACTAATAGG + Intergenic
1099602795 12:84763003-84763025 AACAAGATGCTGAAAATAAGTGG + Intergenic
1100572981 12:95860131-95860153 AAGTAATTGCTGTAAGTAAGAGG + Intronic
1100887095 12:99083742-99083764 AACAAATTGCTGGAAGTATGAGG - Intronic
1101110079 12:101477922-101477944 TAAGAATTGCTGAACCTGAGAGG + Intronic
1106307738 13:28528338-28528360 CACGCATTGCTGAAACTATCAGG - Intergenic
1109057413 13:57568997-57569019 AACGTATTTATGAAACTAAGAGG + Intergenic
1109416072 13:62043117-62043139 AACCAACTGTTGAAACTAATAGG + Intergenic
1109895260 13:68678745-68678767 CACGATTTGATGAAAATAAGAGG + Intergenic
1110254562 13:73418286-73418308 AACAATTGGCTGAAGCTAAGGGG - Intergenic
1110382100 13:74864490-74864512 AATGAATTGATGAGAGTAAGTGG + Intergenic
1112845156 13:103633620-103633642 ATTGTATTGCTAAAACTAAGTGG + Intergenic
1112904772 13:104403312-104403334 AAAGAATTGCTGAAAATTATAGG + Intergenic
1114324065 14:21571291-21571313 AAGGAAATGCAGAAAATAAGTGG + Intergenic
1115390220 14:32845906-32845928 AAAGCATAGCTGAAGCTAAGGGG - Intergenic
1115582494 14:34775283-34775305 AAAGAATTGCTTAAATTTAGGGG - Intronic
1116629381 14:47310496-47310518 AACGACTTGTATAAACTAAGTGG + Intronic
1116755155 14:48939217-48939239 AATGAATGGGTTAAACTAAGTGG + Intergenic
1118869992 14:69733499-69733521 TAACAATTGCTGAATCTAAGTGG + Intronic
1121148734 14:91610389-91610411 AAAGAAATGCTGAAACTGAATGG + Intronic
1129286640 15:74530850-74530872 CAAGTATTGGTGAAACTAAGAGG - Intergenic
1130361909 15:83196878-83196900 AACAATTTGCTGAAAATGAGGGG + Intronic
1139598795 16:67973744-67973766 AACAAATTGCTGAAATTATAAGG + Intergenic
1141682780 16:85554038-85554060 CACGACTTGGTGACACTAAGGGG - Intergenic
1141925851 16:87168914-87168936 AAAGAGTTGCTGAAACTACTGGG - Intronic
1143069339 17:4277344-4277366 AACAAATTACTAAAACTTAGTGG - Intronic
1144233746 17:13235758-13235780 AACAAATTACTTAAACTCAGTGG - Intergenic
1146501838 17:33371383-33371405 AAAGCATTGCTGAAAGCAAGAGG + Intronic
1146532399 17:33620369-33620391 AACGAATTGCTGAAATTTGGTGG - Intronic
1148198888 17:45734778-45734800 AACCAATTATTGAAACTCAGAGG + Intergenic
1152540830 17:80973954-80973976 AAAACATTGCTGAAAGTAAGAGG + Intergenic
1156112868 18:33748382-33748404 AACAAATTGCTGATAGTGAGAGG + Exonic
1159909021 18:74126206-74126228 AATGATGTGCTCAAACTAAGTGG + Intronic
1166866265 19:45839410-45839432 AACAAATTCCTGATAGTAAGTGG + Intronic
1168524403 19:57077358-57077380 AAAGAAATGCTGAAGTTAAGGGG + Intergenic
927743659 2:25595373-25595395 AACGTTTTGCTAAAACTAATAGG - Intronic
932928503 2:76004984-76005006 TACAAAGTGCTGAAAATAAGGGG - Intergenic
933567893 2:83973399-83973421 AAGGAATTGTTGCAAGTAAGGGG + Intergenic
933824466 2:86146272-86146294 AACTACTTGCTGAAGCAAAGAGG + Intronic
938419079 2:131129428-131129450 AAGGAATTGATGAAGATAAGAGG + Intronic
939424231 2:142014116-142014138 AGGGAATTCCTGAAAGTAAGAGG - Intronic
939580474 2:143940500-143940522 TATGAATTTCTGAAAATAAGGGG - Exonic
941946380 2:171102951-171102973 AAAGAAGTGGAGAAACTAAGGGG + Intronic
942080754 2:172397421-172397443 AACAAGTTGTTGAACCTAAGTGG - Intergenic
942179666 2:173367929-173367951 AAAGAAATTCAGAAACTAAGCGG - Exonic
942712712 2:178855171-178855193 ATAGAATTGCTGGACCTAAGGGG - Intronic
942769074 2:179494680-179494702 AACTGGTTGCTGAATCTAAGAGG - Intronic
948085911 2:235247808-235247830 AACGAAAAGCTGAAAATATGGGG + Intergenic
1169752966 20:9013942-9013964 AACTAAGTTTTGAAACTAAGTGG - Intergenic
1183030106 22:35097333-35097355 ACCGAGTTGCTGAAAGTAGGTGG - Intergenic
949703788 3:6791695-6791717 ATCAAATTGCTGAAAGTCAGAGG - Intronic
955185641 3:56712340-56712362 CCCGAATAGCTGAAACTAATAGG + Intergenic
963395184 3:144723213-144723235 AATGAATTGTTGATACTAATAGG - Intergenic
963806702 3:149729835-149729857 AACCAATTGCTGCATTTAAGAGG - Intronic
965314237 3:167171305-167171327 AGTGAATTATTGAAACTAAGGGG - Intergenic
965636805 3:170790194-170790216 TTTGAATTGCTGAAACTAAATGG + Intronic
966541416 3:181094636-181094658 AAGGACTTGAGGAAACTAAGTGG - Intergenic
967898244 3:194418116-194418138 AAGCAATTGCTGAAACAAATGGG + Intronic
968429613 4:548939-548961 AATGAATTACTGATGCTAAGTGG - Intergenic
969822134 4:9728813-9728835 AATGAATTGGTGAAACACAGAGG - Intergenic
970397089 4:15679876-15679898 AAAGAATTGCTGGATCCAAGAGG - Intronic
970865894 4:20758297-20758319 AAAGAATTACTGAAAGAAAGAGG + Intronic
971355569 4:25891868-25891890 AGAGAATTGCTGAAAGTCAGAGG - Intronic
972722514 4:41714392-41714414 AACGAATTGCTGTGCATAAGAGG + Intergenic
974971769 4:68838966-68838988 AACAAATTGCAAAAATTAAGTGG - Intergenic
975766374 4:77672507-77672529 CTCGAATGGCTAAAACTAAGAGG - Intergenic
978237820 4:106481475-106481497 AATTAATTGATGAAATTAAGAGG + Intergenic
979347144 4:119601575-119601597 ATCTAATTACTGAACCTAAGCGG + Intronic
998806665 5:145923569-145923591 AATGATTTGCTGAAATTGAGTGG + Intergenic
1000904307 5:166945179-166945201 AAAGAATAGTTGAAACTATGAGG + Intergenic
1001151363 5:169230936-169230958 AAATAATTGTTGAATCTAAGTGG - Intronic
1002214805 5:177623331-177623353 AAAGACTTGCTGAAAGTAAAAGG - Intergenic
1002407163 5:179044102-179044124 AAAGAAATGCTGAAAATAAAGGG + Intergenic
1004017273 6:11743740-11743762 AACGAATCAATGAAACAAAGTGG + Intronic
1005607396 6:27488464-27488486 AACATATTGCTGAAATTAAAAGG - Intergenic
1006494238 6:34410018-34410040 GAAGAATTGCTCAAACCAAGGGG + Intronic
1007146457 6:39638747-39638769 AAGGAATTGCTGGAACTAGTAGG + Intronic
1008219495 6:48838173-48838195 AGGGCATTGCTGAAAGTAAGAGG + Intergenic
1011485924 6:87841273-87841295 AACAAATTACCAAAACTAAGTGG - Intergenic
1012704711 6:102507685-102507707 AAAGATTTACTGAAACTCAGAGG - Intergenic
1013391909 6:109693774-109693796 AACCATTTGCTGAAACAAAGAGG - Intronic
1014780019 6:125554040-125554062 AACCAAATTCTAAAACTAAGAGG - Intergenic
1016182105 6:141159711-141159733 AAAGAATTGCTTAAGATAAGGGG - Intergenic
1017411200 6:154169389-154169411 CAGGTATTGCTGAAACTCAGTGG + Intronic
1018323461 6:162637774-162637796 AAAGAAGTTCTGAAACTAAATGG - Intronic
1019942376 7:4301781-4301803 CCGGAATTGCTGAAACCAAGGGG - Intergenic
1020316720 7:6910685-6910707 AATGAATTGATGAAACACAGAGG + Intergenic
1021535356 7:21698003-21698025 TACAAATTGCTGAAATCAAGTGG - Intronic
1023122877 7:36926753-36926775 AACTCATTGCTGAAGCTCAGAGG + Intronic
1024557807 7:50618460-50618482 AAAGAATTCCTGAAACTAAAAGG + Intronic
1026400929 7:70012085-70012107 AACGCTTTGCAGAAAGTAAGGGG - Intronic
1027391652 7:77709709-77709731 AACCAAATGCTGAAACTTAGTGG - Intronic
1028270130 7:88777862-88777884 AAAAAATTGCAGAAACTGAGAGG + Intronic
1029329615 7:99841264-99841286 CACGAATTGGTAAAACTTAGTGG - Intronic
1030551253 7:110963109-110963131 AAGCAAATGCAGAAACTAAGAGG - Intronic
1031465173 7:122100882-122100904 AAACAATTGATGAAAGTAAGAGG - Intronic
1038956387 8:32472810-32472832 AAAGAAATGCTGAGACTAAGTGG + Intronic
1041586040 8:59520777-59520799 CCCAAACTGCTGAAACTAAGGGG + Intergenic
1046502681 8:115098540-115098562 AATGAATTGCTGATATTAGGGGG - Intergenic
1050472842 9:6010048-6010070 AACAACTTTCTTAAACTAAGAGG - Intergenic
1052384008 9:27803962-27803984 AATAAATTGCTGAAATCAAGAGG - Intergenic
1056089006 9:83186092-83186114 AAAGATCTGCTGAAACTAACGGG + Intergenic
1058265263 9:102890839-102890861 AACAAATTGCTGAAACGCAAAGG - Intergenic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1193814967 X:86093924-86093946 AATCAGTTGCTGAAAATAAGAGG + Intergenic
1197773303 X:130104392-130104414 CACCCATTTCTGAAACTAAGCGG - Intronic
1198554211 X:137775628-137775650 AACGAATTACTCAAACTTAGTGG + Intergenic