ID: 1087750882

View in Genome Browser
Species Human (GRCh38)
Location 11:102005650-102005672
Sequence GGTGGTGAAGCCTCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087750882_1087750887 14 Left 1087750882 11:102005650-102005672 CCCACAGGGGAGGCTTCACCACC No data
Right 1087750887 11:102005687-102005709 CACAAGCACTCATTTGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087750882 Original CRISPR GGTGGTGAAGCCTCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr