ID: 1087755167

View in Genome Browser
Species Human (GRCh38)
Location 11:102047547-102047569
Sequence GCTCTAAGGAGATCACCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087755163_1087755167 2 Left 1087755163 11:102047522-102047544 CCTCAGAAAACCTTCCAGTCTCT 0: 1
1: 0
2: 3
3: 33
4: 318
Right 1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91
1087755164_1087755167 -8 Left 1087755164 11:102047532-102047554 CCTTCCAGTCTCTGAGCTCTAAG 0: 1
1: 0
2: 2
3: 35
4: 284
Right 1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG 0: 1
1: 0
2: 1
3: 4
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087755167 Original CRISPR GCTCTAAGGAGATCACCAGC CGG Exonic
902938197 1:19779973-19779995 GCTCTAAGGAACTCACAATCTGG - Intronic
905140663 1:35841318-35841340 GCTCTTGGGAGATCTCCTGCCGG - Exonic
906008932 1:42504433-42504455 GCCCTGTGGAGAACACCAGCTGG + Intronic
907444688 1:54499982-54500004 GCTCTGGGGAGATAACAAGCAGG - Intergenic
908642603 1:66242038-66242060 GCTTCAAGGAGGTCACCATCTGG + Intronic
908903735 1:68984972-68984994 CCTCCAAGGAGTTCACCAGTAGG + Intergenic
911266992 1:95754138-95754160 ACTCAAAGGAGACCAGCAGCGGG - Intergenic
912711603 1:111953946-111953968 CCTCTATGGACATCATCAGCAGG + Intronic
916995002 1:170287083-170287105 CCTCAAAGGAGCTCACAAGCTGG - Intergenic
1071435496 10:85645574-85645596 TCTCTAAGGAGACCACCAAATGG + Intronic
1074656520 10:115594835-115594857 TCTCTAAAGAGATCAGCAGGTGG + Intronic
1081765483 11:45607063-45607085 GCTCTAAGACTATCCCCAGCAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082687665 11:56260135-56260157 GCTCTAAGGAGACCTGCAGTGGG + Intergenic
1082758682 11:57104515-57104537 CCTCTAAGGTGTTCTCCAGCTGG + Intergenic
1083176369 11:60952345-60952367 GCTCTAAGGAGGCCAGCAGCGGG - Intronic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1091310844 11:134574199-134574221 ACTCTAAGGAGGTGGCCAGCGGG - Intergenic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097905839 12:64918963-64918985 GCACAGAGGAGAGCACCAGCTGG + Intergenic
1099913358 12:88861013-88861035 GCTCCTTGGAGATCACTAGCTGG - Intergenic
1102111310 12:110367270-110367292 GCACAAAGGAGGTCACCAGAGGG + Intergenic
1105619192 13:22050640-22050662 GCTCTCACCAGAACACCAGCAGG - Intergenic
1111888688 13:94054566-94054588 GCTCTAAGGAGGCCAGCAGCTGG - Intronic
1114512906 14:23277109-23277131 GGTCTCAGTAGTTCACCAGCGGG - Exonic
1118592187 14:67410150-67410172 GCTCCCAGGATATCACCAGGAGG - Intronic
1120473688 14:84959670-84959692 TTTTTAAGGAGATCACCAGAAGG - Intergenic
1121712874 14:96052422-96052444 GCTCCAAGCAGCTCACCATCAGG + Intronic
1123672290 15:22671274-22671296 GCTCTAAGCTGAGCACCACCTGG - Intergenic
1124324338 15:28744566-28744588 GCTCTAAGCTGAGCACCACCTGG - Intergenic
1124528218 15:30477604-30477626 GCTCTAAGCTGAGCACCACCTGG - Intergenic
1124770439 15:32530099-32530121 GCTCTAAGCTGAGCACCACCTGG + Intergenic
1132104313 15:99051675-99051697 TCCCTCAGGAGATCTCCAGCAGG + Intergenic
1132274375 15:100554129-100554151 ACTCTAAGGAGATCATCTACAGG - Intergenic
1132381638 15:101370435-101370457 GCTCCAAGTAGACCACCCGCTGG + Exonic
1133155741 16:3874334-3874356 GCTTTAAGGAAAACAGCAGCAGG - Intronic
1133564168 16:6977633-6977655 GAGCTAAAGAGATGACCAGCCGG - Intronic
1137762856 16:50954696-50954718 TTTCTAGGGAGATCTCCAGCAGG - Intergenic
1138691524 16:58773296-58773318 TCTCTAAGGAGAGCAGGAGCAGG - Intergenic
1142476099 17:191171-191193 GGTCTAAGGAAAACCCCAGCTGG + Intergenic
1148837531 17:50473712-50473734 GCTCTAAGGATATGATCATCCGG + Exonic
1151518952 17:74614906-74614928 GCTTTAGGGAGATCATGAGCTGG - Intronic
1154431465 18:14311646-14311668 ACTCTCAGGAGATCAGCATCAGG - Intergenic
1154434147 18:14330950-14330972 ACTCTCAGGAGATCAGCATCAGG - Intergenic
1160006069 18:75069887-75069909 CCCCTAAAGAGCTCACCAGCTGG + Intergenic
1161200601 19:3012693-3012715 GCTCTGAGGAAAGCAGCAGCTGG + Intronic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1167564836 19:50249643-50249665 GCTCGAAGGAGTTCAGCTGCAGG - Exonic
925584360 2:5448660-5448682 TCTCTAAGGAGACCTCCATCTGG - Intergenic
925702428 2:6651900-6651922 ACTATAAAGAGATCATCAGCTGG - Intergenic
926194676 2:10755573-10755595 ACTCTGAGGAGTTCACCAGCTGG - Intronic
926438478 2:12861758-12861780 GCTCTAAGGAGAGGTCCACCGGG + Intergenic
931189821 2:59989523-59989545 GCTCTGATGAGATGTCCAGCTGG - Intergenic
931906741 2:66850721-66850743 GGTCTCAGGAGGTCAGCAGCGGG - Intergenic
932302216 2:70675479-70675501 GTTCTAGGGAGCTGACCAGCCGG + Intronic
933611112 2:84436478-84436500 TCTCTAAGGAGACTACCTGCTGG + Intronic
933850348 2:86361537-86361559 GCCCTAGGGAGACCCCCAGCTGG - Intergenic
939136223 2:138297804-138297826 GCTCTCAGGAGATTAGCAACAGG - Intergenic
939868533 2:147502323-147502345 GCTCGAAGGAGATGTCCAGTAGG - Intergenic
941547480 2:166870534-166870556 GCTCTAGGGAGTTCAGCTGCAGG + Intergenic
947240690 2:227991116-227991138 GGTCAAAGTTGATCACCAGCAGG + Exonic
948186492 2:236025660-236025682 GCACATAGGAGATCACCACCAGG + Intronic
1169755517 20:9039260-9039282 CCTCTTAGAAGATCATCAGCAGG - Intergenic
1170281708 20:14656323-14656345 GCTATAAGGAGATCGCCAATTGG - Intronic
1173293885 20:41738750-41738772 GCTCTTTGGAGAACACCACCGGG - Intergenic
1178160577 21:29908420-29908442 GCTCTAAGAAGAGCACCAGCAGG - Intronic
1179019937 21:37630279-37630301 GCTCAAAGGAGATCAAGATCAGG - Intronic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1182104758 22:27681522-27681544 GCTCTAGGGAGAGCACCTGGGGG + Intergenic
1183365035 22:37402500-37402522 CCTCTAGTGAGATCACCAGTTGG - Intronic
961756461 3:129130055-129130077 ACTCCAAGGAGAGCCCCAGCTGG + Exonic
979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG + Intronic
984651066 4:182271206-182271228 GCTGTAAGGCGATAACTAGCTGG - Intronic
992210633 5:74476367-74476389 GCTCTAAGGAGGAAGCCAGCTGG - Intergenic
995558200 5:113352567-113352589 GCTGTAAAGAGCTCACCATCTGG + Intronic
996409203 5:123138797-123138819 GGTCTAAGGAGAGAAGCAGCAGG + Intronic
999926705 5:156386685-156386707 GCCCCAAGGGGATCACCATCAGG - Intronic
1000382116 5:160638522-160638544 GCTGTAAGGAGAGCACCTGGGGG - Intronic
1005947765 6:30606763-30606785 GGACTAAGGAGCTTACCAGCAGG + Exonic
1007958909 6:45941181-45941203 GCTCTAATGTGATCACAGGCAGG + Intronic
1008052751 6:46916482-46916504 GCTCTGAGCACATCAGCAGCAGG - Intronic
1011146791 6:84227173-84227195 GCTCTAGGGAGTTCAGGAGCTGG - Intronic
1013669183 6:112380294-112380316 GCTGGAATGAGATCACCTGCAGG + Intergenic
1018763614 6:166911813-166911835 TTTCTAAGGTGATCACCAGGAGG - Intronic
1020372779 7:7452436-7452458 GGTTTTAGGAGATCAACAGCAGG - Intronic
1023580703 7:41679865-41679887 CCTCTCTGTAGATCACCAGCCGG + Intergenic
1026370128 7:69690919-69690941 GCTCTTAGGAGATCAGAAGTGGG + Intronic
1032681821 7:134192882-134192904 GCTATAAGGGAATCACCAGTTGG - Intronic
1035757972 8:2048337-2048359 TCTCTCTGGAGTTCACCAGCAGG - Intronic
1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG + Intergenic
1039786889 8:40841874-40841896 GTCCTAAAGAGATCACCTGCAGG + Intronic
1039808908 8:41027382-41027404 TCTCTAAAGAGTTCAACAGCAGG + Intergenic
1045480105 8:102584920-102584942 GCCCTCAGGAGTTCACCAGAGGG + Intergenic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1190112784 X:47605555-47605577 GCTTAAAGGGGATCACCAGGTGG - Intronic
1197819793 X:130531306-130531328 GCTGCAATGAGATCACCACCAGG - Intergenic
1198920346 X:141718753-141718775 GCAGTAAGGAGATAACAAGCTGG - Intergenic