ID: 1087756818

View in Genome Browser
Species Human (GRCh38)
Location 11:102063200-102063222
Sequence TGCCACCTCGGTGGGTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087756814_1087756818 -5 Left 1087756814 11:102063182-102063204 CCAGGGTAGAAGCAAGACTGCCA 0: 1
1: 0
2: 0
3: 15
4: 300
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756808_1087756818 21 Left 1087756808 11:102063156-102063178 CCGGAGCCTTCAGGGCTCTACCG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756812_1087756818 1 Left 1087756812 11:102063176-102063198 CCGCCACCAGGGTAGAAGCAAGA 0: 1
1: 0
2: 0
3: 15
4: 205
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756807_1087756818 22 Left 1087756807 11:102063155-102063177 CCCGGAGCCTTCAGGGCTCTACC 0: 1
1: 0
2: 0
3: 24
4: 177
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756806_1087756818 25 Left 1087756806 11:102063152-102063174 CCACCCGGAGCCTTCAGGGCTCT 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756809_1087756818 15 Left 1087756809 11:102063162-102063184 CCTTCAGGGCTCTACCGCCACCA 0: 1
1: 0
2: 0
3: 9
4: 130
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132
1087756813_1087756818 -2 Left 1087756813 11:102063179-102063201 CCACCAGGGTAGAAGCAAGACTG 0: 1
1: 0
2: 0
3: 14
4: 286
Right 1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG 0: 1
1: 0
2: 2
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087756818 Original CRISPR TGCCACCTCGGTGGGTCCAG AGG Intronic
902226667 1:15000502-15000524 AGGCACCTCGGGGGGTACAGAGG + Intronic
903178845 1:21595432-21595454 TGCCACCTTCCTGGTTCCAGGGG + Intergenic
903750616 1:25618138-25618160 GGCCTCCTCGCGGGGTCCAGTGG - Exonic
904493949 1:30876555-30876577 AGCCACCTCTGTGGGTCCAGGGG + Exonic
905799667 1:40835089-40835111 TGCAAACTCGGTGGGTGCACCGG + Exonic
907318464 1:53587781-53587803 TGCCCCCTGGCTGGGTCCTGGGG - Intronic
907825665 1:58014681-58014703 TTCCATCTCAGTGGCTCCAGGGG + Intronic
912464832 1:109864806-109864828 TTCCACTTGGGTGGGTGCAGTGG + Intergenic
916570311 1:166019714-166019736 TGCCACCTGGGTTGGTCCCTAGG + Intergenic
920871467 1:209798536-209798558 TGCAATCTGGGTGGGTCCTGGGG - Intronic
922574018 1:226650609-226650631 AGCCATTACGGTGGGTCCAGGGG + Intronic
924594625 1:245434623-245434645 TGCCCCCTGTGTGGGTGCAGGGG - Intronic
1065882396 10:30047839-30047861 TGCCACCACCATGGTTCCAGTGG - Exonic
1066193818 10:33079518-33079540 AGCCACCTGGCTGGGTGCAGTGG - Intergenic
1069914377 10:71778299-71778321 TACCACCACGGTGGGTGCATGGG + Intronic
1075746929 10:124734588-124734610 AGCCACCTTGGTGGGTCCTCTGG + Intronic
1077834455 11:5912792-5912814 TGACACCTGGGAGGTTCCAGTGG - Intronic
1081615917 11:44591180-44591202 AGGCAGCTGGGTGGGTCCAGAGG - Intronic
1082836224 11:57652417-57652439 TGCAACCTCTGTGAGTACAGTGG - Intronic
1083706181 11:64518004-64518026 TGCCGCCTCAGTGGGTCCCAGGG + Intergenic
1084190834 11:67498019-67498041 TGCGACCTGGGTGGGAGCAGGGG + Exonic
1084717024 11:70880562-70880584 TGCCCCCTCTGTGAGGCCAGGGG + Intronic
1084752435 11:71213101-71213123 TGCCACCCAGGTAAGTCCAGGGG + Intronic
1087756818 11:102063200-102063222 TGCCACCTCGGTGGGTCCAGAGG + Intronic
1089687589 11:120166550-120166572 TACCACATGGGTGGGTTCAGTGG - Intronic
1090461119 11:126892321-126892343 TGCTTCCACGGTGGGTCCTGAGG - Intronic
1091287791 11:134417844-134417866 TGCCACCCTGTTGGCTCCAGGGG - Intergenic
1093997577 12:25658505-25658527 TGCCACATTGGGTGGTCCAGAGG + Intergenic
1097007281 12:55928308-55928330 TGCCTCCTCCCTGGTTCCAGGGG - Intronic
1097139336 12:56886756-56886778 TGCCACCTCTGTGGCTCTACAGG - Intergenic
1102047721 12:109840235-109840257 ACCCCCCTCGGTGGGTCCTGAGG - Intergenic
1102441739 12:112968848-112968870 TGGCACCTGGGTGGGTTCACAGG - Intronic
1104934817 12:132358802-132358824 AGCCACCTCTGTGAGTCCCGTGG + Intergenic
1107822203 13:44296136-44296158 AGCCACCTCCCTGGGTCCTGAGG + Intergenic
1108123976 13:47220630-47220652 TGCCACCCCAGTGGGCCGAGAGG - Intergenic
1112467345 13:99655530-99655552 TGCCACCTTGGTGGCTGGAGGGG + Intronic
1113945671 13:114042840-114042862 TGCCATCTCAGTCGGTCCTGCGG + Intronic
1119087037 14:71748520-71748542 TGACACCTCAGTGGGGACAGTGG + Intergenic
1121092862 14:91194894-91194916 TGCCACCCCAGTGGGTCAATGGG - Intronic
1122878659 14:104680158-104680180 TCCCACCTCAGTGTGTGCAGAGG + Intergenic
1123004270 14:105314147-105314169 TGCCACCTCCCTGCGTCCCGGGG + Exonic
1126758769 15:51950122-51950144 TCCCACCTCTGTGGCTCCACAGG + Intronic
1126903261 15:53336543-53336565 TGCCACCCCAGTGGGCCTAGAGG - Intergenic
1132645415 16:997235-997257 TGCTGCCTGGGTGTGTCCAGTGG - Intergenic
1133317537 16:4893682-4893704 TCCCGCCTCTGTGGGTGCAGGGG - Intronic
1134865221 16:17600931-17600953 TGGAACCTAGGTGGGTCTAGCGG + Intergenic
1138148274 16:54631633-54631655 TGGGACCTCGGTTGATCCAGGGG - Intergenic
1138453067 16:57105377-57105399 TGCCTCCTCGCTGGGGTCAGTGG + Intronic
1139947912 16:70654284-70654306 TGCCTCCTGGGGGGCTCCAGTGG + Intronic
1141147673 16:81543062-81543084 TGCCACCTCATGGGCTCCAGCGG - Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1144753588 17:17666620-17666642 TGCCCCCTCGGAGGCGCCAGGGG + Intergenic
1146833217 17:36088626-36088648 AGCGACCTCGGTGGGCCCAGTGG - Exonic
1146847736 17:36195240-36195262 AGCGACCTCAGTGGGCCCAGTGG - Exonic
1146947790 17:36885540-36885562 TGTCACCTCGGGGAGTCGAGGGG + Intergenic
1148332747 17:46821849-46821871 TGCCTCCGCAGGGGGTCCAGTGG - Intronic
1148463204 17:47849950-47849972 TGCCACCTCCCTGGTCCCAGAGG - Intronic
1150294401 17:64000124-64000146 TGACACATAGGTGGGTCCAGGGG + Intronic
1152525715 17:80887286-80887308 TGCCACCTCGGGGGGTGCGCTGG + Intronic
1153290024 18:3492044-3492066 TGACACCTGGGTGTGTCTAGTGG + Intergenic
1154175594 18:12086004-12086026 TGCAGCCCCGGTGGGCCCAGCGG + Intergenic
1154305672 18:13229099-13229121 TGCCTCCTCGGTGGGTCCAATGG - Intronic
1155054818 18:22173364-22173386 TGCCACCTCTGTGACTCAAGGGG - Intronic
1159555724 18:69942719-69942741 GGCCACCTCTGTGGGTGTAGGGG + Intronic
1160411557 18:78678509-78678531 TGCCCCCTCTGGGGCTCCAGGGG + Intergenic
1162464893 19:10833783-10833805 TGCCACCTCAGTGGGACTACGGG - Intronic
1162518786 19:11166723-11166745 CGCCACCTCCTTGGGGCCAGGGG - Intronic
1163370068 19:16896767-16896789 TACCCCCTCGGTGGGTCTTGGGG + Intronic
1163676151 19:18656281-18656303 TGCCACCTCACTGGGTCCTTGGG + Intronic
1164035350 19:21449327-21449349 TGCCACCTCGGGGAGGACAGAGG + Intronic
1164061408 19:21678395-21678417 TGCCACCTCGGAGAGGACAGAGG + Intergenic
1166199413 19:41226606-41226628 TGCCAACGCGGTGGGAACAGAGG + Intronic
1166879975 19:45922905-45922927 TGACACCTGGGTGGCTACAGAGG - Intergenic
1167556506 19:50199471-50199493 TGACCCCTCTGTGGGTCCTGTGG - Intronic
1168714372 19:58518475-58518497 TGCCATCTCGATGGGGCCTGTGG + Intronic
926589045 2:14720176-14720198 TGCCATCTTGGTGACTCCAGGGG + Intergenic
927852234 2:26506578-26506600 TTCCACCTGGGTGAGTCCATGGG - Intronic
930728724 2:54708579-54708601 TGCCACCACGCTGGCTGCAGTGG + Intergenic
931161873 2:59701954-59701976 GGTCCCCTAGGTGGGTCCAGAGG + Intergenic
932302209 2:70675457-70675479 TGCCACCTCTGTGGAGCCCGTGG + Intronic
936111774 2:109670895-109670917 TGCAGCCTCAGTGGGCCCAGTGG + Intergenic
940285283 2:152027533-152027555 TGCTACCTCTTTGGCTCCAGTGG + Intronic
944106801 2:196087751-196087773 TACCACCTGGCTGGGTGCAGTGG - Intergenic
946165667 2:217862410-217862432 GGCCACCTCAGGGGGTACAGGGG - Intronic
948099127 2:235359633-235359655 TGGCACCTCAGTGGGAACAGGGG + Intergenic
1169544818 20:6639363-6639385 TGCCACCTCCTTGGGCCAAGGGG - Intergenic
1171967905 20:31544218-31544240 TGCCACCAGGCTGGGTCAAGAGG + Intronic
1174500592 20:50981259-50981281 GGCCTCCTCGGTGGGCCCTGTGG + Intergenic
1174845811 20:53942200-53942222 TTTCACCTCGCTGGGTACAGGGG - Intronic
1176927365 21:14766393-14766415 TGCCACCTGCCTGGGTGCAGGGG + Intergenic
1182298938 22:29327366-29327388 TGCCATCTGGGAGGCTCCAGGGG - Intergenic
1182669080 22:31980758-31980780 TGACACCTCTGAGGGTTCAGGGG + Intergenic
1183002661 22:34874610-34874632 GGCCACCTCTGGGGGTGCAGGGG + Intergenic
1183219243 22:36501746-36501768 TGCCTCCTGGCTGGGTGCAGTGG - Intronic
1185164418 22:49252049-49252071 TGAAACCCCGGTGGGTCCAGAGG - Intergenic
953431684 3:42845399-42845421 TGTCACCTAGGTTGGTGCAGTGG + Intronic
955112015 3:55958982-55959004 TGCATGCTCTGTGGGTCCAGCGG - Intronic
955161262 3:56467748-56467770 GGCCGCCTGGGTGGGTTCAGAGG - Intronic
956990105 3:74752346-74752368 TGCCTGCTCCGTGGATCCAGGGG + Intergenic
978008586 4:103651190-103651212 TTCCTCCTAGGTGGGTCCAGAGG + Intronic
979388657 4:120100530-120100552 TGCCACCCCCGTGGGCCCACAGG - Intergenic
985488023 5:162805-162827 GGCTACCTCGGTGGCTGCAGAGG + Exonic
986880293 5:12161632-12161654 GGCTGCCTCAGTGGGTCCAGAGG + Intergenic
988408137 5:30850720-30850742 AGCCAACTCAGTGGGTCCTGTGG - Intergenic
991987800 5:72308087-72308109 TGCGCCCGCGGTGCGTCCAGAGG - Intronic
997025742 5:130058817-130058839 TACTACCTCTGTGGCTCCAGGGG + Intronic
1000012903 5:157249456-157249478 AGCCACCTGGGCGGGTACAGAGG - Intronic
1002696262 5:181093144-181093166 TGACACCTGGGTGGTCCCAGTGG + Intergenic
1003019828 6:2500174-2500196 TGTCACCTAGGTGGGGTCAGTGG + Intergenic
1007192041 6:40027671-40027693 TTCCACCTTAGTGGGTCTAGAGG + Intergenic
1007230695 6:40345808-40345830 TGCCTCCTCTGTGGCTCCTGTGG - Intergenic
1010162297 6:72870536-72870558 TGCCACCCGGCTGGGTGCAGTGG - Intronic
1019528121 7:1489997-1490019 TTCCATCTCGGTGGCTCCTGGGG - Intronic
1019618724 7:1979164-1979186 TGCTGCCGCGGGGGGTCCAGGGG + Intronic
1020030433 7:4929113-4929135 TGGCGCCTGGGTGAGTCCAGGGG + Intronic
1021538264 7:21728933-21728955 TGCCGCCTTAGTGTGTCCAGAGG - Intronic
1023469110 7:40494192-40494214 GGCCACTTTGGTGAGTCCAGTGG + Intronic
1024547750 7:50536585-50536607 TGACACCTTGGAGGCTCCAGGGG - Intronic
1028440771 7:90857813-90857835 TGGCACCTCACTGGGACCAGTGG + Intronic
1029712479 7:102307259-102307281 AGGCACCCCGGTGGGTCTAGGGG + Intronic
1030112250 7:106036905-106036927 TGACACATAGGAGGGTCCAGGGG - Intergenic
1035292588 7:157849211-157849233 TGCCTCTTCGGTGGGAACAGTGG - Intronic
1037634863 8:20692457-20692479 TGCAACCTCCCAGGGTCCAGAGG - Intergenic
1038479450 8:27891815-27891837 TGCCACCTCGATGTGTACAGAGG - Intronic
1048709904 8:137198075-137198097 TGTCACCTCTGTGGGACAAGGGG - Intergenic
1049780132 8:144425107-144425129 TACCCCCTCGGCTGGTCCAGAGG + Intronic
1053690947 9:40587319-40587341 TGCAGCCCCGGTGGGCCCAGTGG + Intergenic
1054273857 9:63050172-63050194 TGCAGCCCCGGTGGGCCCAGTGG - Intergenic
1054302207 9:63388290-63388312 TGCAGCCCCGGTGGGCCCAGTGG + Intergenic
1054400983 9:64714796-64714818 TGCAGCCCCGGTGGGCCCAGTGG + Intergenic
1054434590 9:65199110-65199132 TGCAGCCCCGGTGGGCCCAGTGG + Intergenic
1054495800 9:65822571-65822593 TGCAGCCCCGGTGGGCCCAGTGG - Intergenic
1059549888 9:115218279-115218301 GGCCACCTGGCTGGGTGCAGTGG + Intronic
1060913478 9:127369598-127369620 CTCCACCTCGCTGGGTCCAAGGG - Intronic
1062623419 9:137432779-137432801 TGCCACCTCGGTGGGCCTTGGGG + Intronic
1187326383 X:18294692-18294714 TGCCACTTCGCTGGGTCTAATGG - Intronic
1187872351 X:23775109-23775131 TGCCACCTGGCTGGGCGCAGTGG - Intergenic
1198683226 X:139203794-139203816 CGCCACCACCGTGCGTCCAGAGG + Intronic
1198878811 X:141256528-141256550 TGCCACCTGGCAGGGTGCAGTGG - Intergenic
1199743509 X:150757436-150757458 GGCCAACTCAGAGGGTCCAGAGG - Intronic
1201010812 Y:9547242-9547264 TGCCAGATCTGCGGGTCCAGCGG - Intergenic