ID: 1087757780

View in Genome Browser
Species Human (GRCh38)
Location 11:102073385-102073407
Sequence CAGATGTCAGCAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 4, 2: 7, 3: 51, 4: 345}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087757770_1087757780 6 Left 1087757770 11:102073356-102073378 CCTGTGCTCAGATCCCCAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG 0: 1
1: 4
2: 7
3: 51
4: 345
1087757769_1087757780 19 Left 1087757769 11:102073343-102073365 CCAGTTGAGTAGGCCTGTGCTCA 0: 1
1: 0
2: 0
3: 2
4: 91
Right 1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG 0: 1
1: 4
2: 7
3: 51
4: 345
1087757773_1087757780 -8 Left 1087757773 11:102073370-102073392 CCCAAGAGGAGCACCCAGATGTC 0: 1
1: 0
2: 1
3: 12
4: 174
Right 1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG 0: 1
1: 4
2: 7
3: 51
4: 345
1087757772_1087757780 -7 Left 1087757772 11:102073369-102073391 CCCCAAGAGGAGCACCCAGATGT 0: 1
1: 0
2: 2
3: 26
4: 564
Right 1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG 0: 1
1: 4
2: 7
3: 51
4: 345
1087757774_1087757780 -9 Left 1087757774 11:102073371-102073393 CCAAGAGGAGCACCCAGATGTCA 0: 1
1: 0
2: 0
3: 16
4: 245
Right 1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG 0: 1
1: 4
2: 7
3: 51
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087757780 Original CRISPR CAGATGTCAGCAGTGGTGGA GGG Intronic
900482332 1:2905282-2905304 CACAGATCAGCAGTGTTGGAGGG + Intergenic
900484979 1:2918236-2918258 CTCATGTCAGCGGTGGTGGGAGG + Intergenic
905102434 1:35536477-35536499 TAGATGTCATCAGTGATGCATGG - Intronic
905374406 1:37509437-37509459 CAGCTGTAAGTAGTGGTGGTGGG - Exonic
905424564 1:37872640-37872662 CAGATGGCAGCTGTGATGGCCGG - Intronic
905812920 1:40926153-40926175 CTGATCTCAGCAGTGGGTGAGGG + Intergenic
905982399 1:42241521-42241543 CAGATGCCAGCCATGGTGGGTGG - Intronic
906436170 1:45798530-45798552 CACATGACAGCAGTGGTAGGGGG - Intronic
907518616 1:55008902-55008924 CAGAGGTCAGCTTTGGGGGAAGG - Exonic
908869583 1:68593608-68593630 CACATGGCAGCAGGGGTGAAGGG - Intergenic
908930885 1:69315132-69315154 CAGATGCCAGCAGTGGTGGATGG + Intergenic
909661857 1:78092235-78092257 CAGATGTCAGCAGAAGTCTAGGG - Intronic
911039659 1:93581979-93582001 CTGATGCCAGCAGGGGTGGGTGG + Intronic
912108211 1:106306925-106306947 CAGATGTCAGTAGTGGCAGATGG - Intergenic
912478250 1:109956889-109956911 CAGTTGTCAGAAGTGAAGGATGG + Intergenic
912509152 1:110176553-110176575 CAGATGTGAGCAGGGATGGGGGG + Intronic
912582233 1:110730875-110730897 CAGTTGGCAGCAGAGGTGGGAGG + Intergenic
912957466 1:114165623-114165645 CAGAAGTCAGCTGTGGCTGATGG + Intergenic
914677467 1:149916006-149916028 CAGATGTAAGCAGTGGACCACGG + Intronic
915725122 1:158011763-158011785 CGGAGGGCAGCAGTGGGGGAAGG + Intronic
917084291 1:171290828-171290850 CAGACGACAGCTGTTGTGGACGG - Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917817742 1:178726495-178726517 CTGATGTTAGCTGTGGAGGAGGG + Intronic
920073339 1:203319267-203319289 CAGATGTCAGCAGAGCTGCAAGG - Intergenic
921295512 1:213697607-213697629 CAGAGTTCAGAAGTGGTGGGAGG + Intergenic
921573602 1:216807627-216807649 CAGATCTCAGCTGTGTTAGACGG + Intronic
921874344 1:220177060-220177082 CAGGTGTCTGCACAGGTGGATGG - Intronic
922041887 1:221904839-221904861 CAGCTGTCAGAAGTGGCTGAGGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
924582247 1:245332599-245332621 AACATGTCAGCAGTGGGGGTGGG - Intronic
924653185 1:245948932-245948954 CAGCTGCCCACAGTGGTGGATGG - Intronic
1063647184 10:7896873-7896895 CAGATGTCAGCCCAGTTGGAAGG + Intronic
1063956500 10:11272479-11272501 CAGTTTTCAGAAATGGTGGATGG - Intronic
1064209712 10:13351824-13351846 CAGATGGTGGCAGTGTTGGATGG - Intergenic
1065934849 10:30512286-30512308 CAGATGTGAGCCATGGTGCAGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067410827 10:46063147-46063169 CAGATTTCAGGAGTGTTGGCTGG - Intergenic
1068574140 10:58664922-58664944 CAGATTTCTCCAGTGGTGGATGG + Intronic
1068747991 10:60557033-60557055 CAGACGACAGCAGTGGGGGAGGG - Intronic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069644664 10:69985092-69985114 CAGATGTGAGCCATGGTGCATGG - Intergenic
1070663551 10:78327858-78327880 GTGGTGGCAGCAGTGGTGGAGGG + Intergenic
1070727801 10:78803921-78803943 CTGAGGCCAGCAGTGGTGGCAGG - Intergenic
1072622811 10:97091241-97091263 AAGATGGCAGGAGTGGTGCATGG - Intronic
1072892570 10:99337411-99337433 CAGAGTTCAGCATTGCTGGAGGG - Intronic
1074440677 10:113475035-113475057 GAAATTTCAGCAGTGGTGGAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1076356421 10:129857015-129857037 CAGAGCCCAGCAGTGGGGGAAGG + Intronic
1076756629 10:132576006-132576028 CAGGTGGCATCTGTGGTGGAGGG - Intronic
1076833413 10:133008171-133008193 CACATCCCAGGAGTGGTGGATGG + Intergenic
1076875514 10:133213746-133213768 CAGCTGGGAGCGGTGGTGGAGGG + Intronic
1077383632 11:2258965-2258987 CAGATGTCAGGAGGGGTGAAGGG + Intergenic
1078400570 11:11022784-11022806 TAGATGGCAGCATGGGTGGATGG - Intergenic
1078534341 11:12161076-12161098 CAGCTGTCAGGAGGGCTGGAGGG - Intronic
1078953833 11:16167159-16167181 CAGATATCAGCAGTGAGTGAGGG - Intronic
1080140566 11:28914113-28914135 CATAGGTCAGAAGTGGTGGCAGG - Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081304731 11:41497969-41497991 CAGATGTCTTCAGTGTTGAAGGG - Intergenic
1083505122 11:63149552-63149574 CAGACATCAGCAATGGAGGAAGG + Intronic
1084105356 11:66977050-66977072 CAGGGGTCAGCAGGGGTGGGGGG - Intergenic
1084945315 11:72635019-72635041 GAAATGGCAGCAGTGGAGGAAGG - Intronic
1085831416 11:79905337-79905359 CAGAGGTCAGCAGCTGTGGGAGG - Intergenic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1087013473 11:93534674-93534696 CAGAGAGCAGGAGTGGTGGAGGG - Intronic
1087757780 11:102073385-102073407 CAGATGTCAGCAGTGGTGGAGGG + Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1087992204 11:104758599-104758621 CAGATGCCAGCAGTGGTGAATGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1090477057 11:127032691-127032713 GGGATGTAAGCAGTGGGGGAGGG - Intergenic
1091007018 11:131962553-131962575 CAGATGCCAGCAGATCTGGAGGG - Intronic
1091281029 11:134381793-134381815 CAGATGTGGGCAGGAGTGGAGGG - Exonic
1091423814 12:368239-368261 AAGTTGCCAGGAGTGGTGGAAGG + Intronic
1093437572 12:19153536-19153558 AAGATGTCCACAGTGGGGGAGGG - Intronic
1094033466 12:26040621-26040643 AAGATGTCAGCAGTGTGGCATGG - Intronic
1095225314 12:39671789-39671811 CAGATGCCAGCTGTGGTGGATGG + Intronic
1095832729 12:46604565-46604587 CAGATGCCAACAATGGTGGATGG - Intergenic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097173505 12:57129755-57129777 CAGATGTCATCACTGGGGAAGGG + Intronic
1097555147 12:61127485-61127507 CAGATTCCAGCAGTGATGGATGG + Intergenic
1098077946 12:66753447-66753469 AGCAGGTCAGCAGTGGTGGAAGG - Intronic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099832790 12:87866745-87866767 CAGATGTCTGGAGAGGTTGAAGG + Intergenic
1101012667 12:100467196-100467218 CAGCTGACTGCAGGGGTGGATGG + Intergenic
1102081654 12:110103190-110103212 AAAATGTCAGCAGTGTTGGAAGG + Intergenic
1102536177 12:113583186-113583208 CACAGCTCTGCAGTGGTGGAGGG + Intergenic
1102707894 12:114898028-114898050 CAGGTGTTAGCAGAGTTGGAAGG + Intergenic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104559968 12:129834583-129834605 CAGAAGCGAGGAGTGGTGGAAGG - Intronic
1104749763 12:131230908-131230930 CAGATGCCAGCAGGGGCTGAGGG - Intergenic
1104808909 12:131608207-131608229 CGGATTCCAGCAGTGGTGGAGGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105927591 13:25021211-25021233 CAGGTGTGAGCAGAGGTGGACGG + Intergenic
1106950089 13:34873809-34873831 CAGTTGTTAGCAGTGGAGGTTGG + Intergenic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109428266 13:62197553-62197575 CACATGGCAGAAGTGATGGAAGG + Intergenic
1111690368 13:91556077-91556099 CAGGGGTCAGAAGTGGTGGAAGG - Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114533528 14:23409593-23409615 GAGATGGCAGCATTGGAGGATGG - Intergenic
1114840834 14:26260571-26260593 CAGTGGTGGGCAGTGGTGGACGG - Intergenic
1114946351 14:27686267-27686289 GAGATGTCTGCAGTGCTGCAGGG + Intergenic
1115343611 14:32318606-32318628 CAGATATCAGTGGTTGTGGATGG + Intergenic
1116012379 14:39366581-39366603 CAGATGCCAGCAGTGGTGGATGG + Intronic
1116686105 14:48040596-48040618 CAGATGCCAGCAGTGGTGGCTGG + Intergenic
1118362185 14:65066004-65066026 CAGAGGCCTGCGGTGGTGGAAGG - Intronic
1119159036 14:72437999-72438021 CAGATGCCATCAGTGGTGGTCGG + Intronic
1119266089 14:73264025-73264047 CACCTGTCAGCGGAGGTGGAGGG - Intronic
1119886693 14:78149503-78149525 TTGATGACAGGAGTGGTGGAAGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121671149 14:95711637-95711659 CAGATGGCAGCAGTCGGGGAGGG + Intronic
1121784730 14:96649070-96649092 CAGATGCCAGCAGTAGCAGATGG + Intergenic
1125405581 15:39349892-39349914 CATATGGCAGAAGAGGTGGAAGG + Intergenic
1125507267 15:40274059-40274081 CTGGTGGCAGCAGTGGTGGAGGG - Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1127410148 15:58697458-58697480 CACATGTTAACGGTGGTGGAGGG - Intronic
1127772082 15:62240646-62240668 CAGATGCCAACAGTGGGAGAGGG - Intergenic
1127851136 15:62912890-62912912 CAGATCTCAGGAGTGGAGGTGGG + Intergenic
1127933320 15:63612282-63612304 GAAATGTCAGCAGTGTTGGCTGG + Exonic
1130140404 15:81221455-81221477 CAAATGTCAGCAGAGCTGGGGGG - Intronic
1130433724 15:83875022-83875044 CAGATGAACACAGTGGTGGATGG - Intronic
1131279322 15:91007945-91007967 CAGATGTGAGCTGTGATGAATGG - Exonic
1132393820 15:101457964-101457986 CAGATGTCAGCGCTGGTAGGGGG - Intronic
1132415358 15:101615264-101615286 CAGATGTGAGGAGAGGTGGGGGG - Intergenic
1133018383 16:2955269-2955291 CAGGTGTCAGGCGTGGAGGAGGG - Intergenic
1134094835 16:11412464-11412486 CAGGTCTCAGCAGTGAGGGAGGG - Intronic
1134624563 16:15714485-15714507 CAGATGGCAGCAGTGCTGAGGGG + Intronic
1135206770 16:20491662-20491684 GAGGTGCCAGCAGTGGTGGCAGG + Intergenic
1135212115 16:20531970-20531992 GAGGTGCCAGCAGTGGTGGCAGG - Intergenic
1135292293 16:21250317-21250339 CAGTTGTCAGCAGAGGAGGACGG + Exonic
1136229130 16:28876770-28876792 GGGATGGCAGCAGGGGTGGATGG - Intergenic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1138153921 16:54685673-54685695 AAGAAGACAGCAGTGGTGCAGGG - Intergenic
1138221038 16:55250665-55250687 CTGGTGGCAGCAGTGCTGGAAGG + Intergenic
1140069243 16:71634824-71634846 CAGATGCAAGTGGTGGTGGAAGG + Intronic
1141289724 16:82706548-82706570 CAGAGGTCAGCGGAGGTGGGTGG + Intronic
1142015681 16:87745541-87745563 CAGAAGCCAGAAGAGGTGGATGG - Intronic
1142599718 17:1047745-1047767 CAGATGGAGGCAGTGGGGGAGGG - Intronic
1146182044 17:30704710-30704732 CAGGTGTGAGCCGTGGTGGCAGG - Intergenic
1147243382 17:39105323-39105345 AAAATGTCAGCACTGGAGGAGGG + Intronic
1148628217 17:49086710-49086732 CAGTTGCCAGCAAGGGTGGAGGG + Intergenic
1149201990 17:54197030-54197052 CAGAAGTCAGCAGTGGGGATGGG - Intergenic
1150183488 17:63153718-63153740 CAGATATCAATAGTGGTAGAAGG - Intronic
1150613156 17:66749491-66749513 CAGGAGTCAGCAGTCCTGGATGG - Intronic
1151191280 17:72399838-72399860 CTGATGACAGGAGGGGTGGAAGG - Intergenic
1151289000 17:73135002-73135024 CAGATTTCAATAGTGGTGCAAGG + Intergenic
1151434020 17:74083031-74083053 CAGATCCCAGCAGGGGTGGGAGG - Intergenic
1151445286 17:74159728-74159750 CAGGGGTCATCTGTGGTGGAGGG - Intergenic
1152058978 17:78054832-78054854 CAGTAGTCTGCAGTGGTGTATGG - Intronic
1152058980 17:78054862-78054884 CAGTAGTCTGCAGTGGTGTATGG - Intronic
1152058983 17:78054892-78054914 CAGTAGTCCGCAGTGGTGTATGG - Intronic
1152058986 17:78054922-78054944 CAGTAGTCCGCAGTGGTGTATGG - Intronic
1152058989 17:78054952-78054974 CAGTAGTCCGCAGTGGTGTATGG - Intronic
1152058992 17:78054982-78055004 CAGTAGTCCGCAGTGGTGTATGG - Intronic
1153056267 18:949613-949635 CAGATGCCAGCAGTGGTGGATGG + Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1154345487 18:13540359-13540381 CAGATGTCTGCAGTTGTTAAGGG + Intronic
1155918145 18:31576164-31576186 CAGAGGTGAGCAGTGAAGGAAGG + Intergenic
1156113858 18:33762287-33762309 CAAATATCATCAGTGGTGGTGGG + Intergenic
1157551220 18:48583035-48583057 CCCATGTCTGCTGTGGTGGAGGG + Intronic
1157587725 18:48815782-48815804 CTGAAGTCAGCAGTGGTGTGGGG + Intronic
1157804607 18:50648873-50648895 GAGTTGTCAGCAATGGTGGCTGG - Intronic
1157820851 18:50767401-50767423 TAGATGCCAGCAGTGGGGGGTGG - Intergenic
1159271627 18:66160304-66160326 CATGTGGCAGAAGTGGTGGAAGG + Intergenic
1159545495 18:69835591-69835613 CAGATGTAAGCATGGATGGATGG - Intronic
1160053433 18:75457287-75457309 CACATGTTAGCAGTGGTTTAAGG - Intergenic
1160393773 18:78557545-78557567 CAGATGTCAGAAGGGGATGATGG + Intergenic
1160424603 18:78771434-78771456 CAGGTGTCAGCAGTATTGGGGGG - Intergenic
1161410719 19:4115722-4115744 CAGGTGGCAGCAGTGCTTGAGGG - Intronic
1161785833 19:6325048-6325070 CAGAAGTCAGCAGTGTGGGAGGG - Intronic
1161854252 19:6754419-6754441 CTGATGCCTGCAGAGGTGGAGGG + Exonic
1162007761 19:7790724-7790746 TGGTTCTCAGCAGTGGTGGATGG - Intergenic
1163312082 19:16520794-16520816 CAGATGTCTGCAGTGGCCGGGGG - Exonic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164636047 19:29792242-29792264 CAGCTGTCTGCAGTGGAGGCAGG - Intergenic
1166027177 19:40097577-40097599 CAGAAGACACCAGTGGTTGATGG + Intergenic
1166592359 19:44011131-44011153 CAGATGTGAGGAGTGTGGGAAGG + Exonic
1166627753 19:44374776-44374798 CAGATATCAGGAATGGTGGAAGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925361860 2:3285345-3285367 CAGGTCCCAGCTGTGGTGGACGG + Intronic
925825630 2:7846112-7846134 GAGAGGTCAGCAGTGTGGGAAGG + Intergenic
925856365 2:8133315-8133337 CAGATTTGAGCAGTGGGGAATGG + Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928480112 2:31675050-31675072 GCTATGTCTGCAGTGGTGGATGG + Intergenic
929093958 2:38246524-38246546 CAGATGTCAGGAGTGGTTCAAGG + Intergenic
929266003 2:39920087-39920109 CAGGTGCCAACAGTAGTGGATGG + Intergenic
929812351 2:45201108-45201130 CAGATCCCTGCAGTGGTGGATGG - Intergenic
930007892 2:46912639-46912661 CAGCTGTCATCAGCTGTGGACGG - Exonic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
931134287 2:59378542-59378564 CAGATGCCAACAGTGGTGAATGG - Intergenic
931448878 2:62350743-62350765 CAGATGGCAGCAGTGATGATAGG - Intergenic
931471321 2:62540440-62540462 CAGCTCTAAGCAGAGGTGGAAGG - Intergenic
931648782 2:64450176-64450198 CAGATGGCAGGCATGGTGGAAGG + Intergenic
931695498 2:64867749-64867771 CTGGTGTCAGCAGTGGTGAGTGG - Intergenic
934582477 2:95455460-95455482 CTGATGTAAACAATGGTGGAAGG - Intergenic
934596973 2:95621254-95621276 CTGATGTAAACAATGGTGGAAGG + Intergenic
935161640 2:100534558-100534580 CAGATGGCAGCAGTGCTCTATGG - Intergenic
935331060 2:101978477-101978499 CAGATGTAAACAGTGGAGGGAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936280407 2:111135423-111135445 CTGGTGTCAGCAGTGGCTGAGGG - Intronic
938545759 2:132329803-132329825 TAGATATCAGGAATGGTGGAAGG + Intergenic
938693808 2:133816295-133816317 CAGATGCCAGCAATGGTGAATGG - Intergenic
940651715 2:156447290-156447312 CAGATTCCAACAGTTGTGGAGGG - Intronic
940794550 2:158063054-158063076 CTGATTTCAGCAGTTGTAGAGGG + Intronic
941903047 2:170696041-170696063 CATTTGTCTGCAGTGGTGGTAGG - Intergenic
944922891 2:204433930-204433952 CATAATTCAGCAATGGTGGAAGG + Intergenic
945835237 2:214831988-214832010 AAGATGTCAGCAGAGGTCTAAGG + Intergenic
946090234 2:217215998-217216020 GAGATGTCAACTGGGGTGGAAGG - Intergenic
946232980 2:218304031-218304053 GAGATGGCAGCAGAGGTGGAGGG + Intronic
948232031 2:236355878-236355900 CAGGTGTCAGCAGAGGTGCCTGG - Intronic
1171391684 20:24805519-24805541 CAGATGCCAGCATGTGTGGACGG - Intergenic
1171874620 20:30562557-30562579 TAGATATCAGGAATGGTGGAAGG + Intergenic
1172901513 20:38338236-38338258 CACATGTCAGCAGTGTAGAAAGG - Intergenic
1174352102 20:49975822-49975844 TAGCTGTCAGCAGGGGTGGAAGG - Intergenic
1175410490 20:58764545-58764567 AAGATGACACCAGTTGTGGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177475466 21:21615087-21615109 CAGATTTCAGCTGCAGTGGATGG - Intergenic
1178773326 21:35526087-35526109 GAGGTGTCAGCAGAGCTGGAGGG - Intronic
1179295063 21:40054422-40054444 AAGATGTCTCCAGTGGTGGGTGG + Intronic
1180079743 21:45481184-45481206 CCGAGGTCAGCATTGCTGGAGGG + Intronic
1181169052 22:20998137-20998159 CTGAAGCCAGCAGTGGTGGCCGG - Exonic
1182133922 22:27883068-27883090 CAGAGTTCAGCAGTTGTGGGAGG + Intronic
1182369511 22:29801073-29801095 GAGACGTCAGCAGGGGTGTAGGG + Exonic
1182596724 22:31426971-31426993 CTGATGTCAGGGGTGATGGAGGG + Intronic
1184342000 22:43891288-43891310 CAGAAGTCTGCAGTGGGGGCAGG + Exonic
1185009320 22:48304510-48304532 GAGATGTCAGCACTGGGGCACGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950205476 3:11076902-11076924 CTTCTGTCAGCAGTGCTGGACGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951360238 3:21716453-21716475 CAGAGGCCAGCATGGGTGGAGGG - Intronic
951390274 3:22094545-22094567 CACATGAAAGCAGAGGTGGAAGG + Intronic
951516608 3:23566793-23566815 CACATGTCAGCAGATTTGGAGGG + Intronic
952543600 3:34395407-34395429 TAGATGTTAGCAGTGGTGTACGG + Intergenic
953129098 3:40120934-40120956 CAGTTGTCAGGACTGGGGGATGG - Intronic
953187436 3:40651921-40651943 GAGATGCCAGCACTGGTGGCTGG + Intergenic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954335201 3:49912224-49912246 CTCATGGCAGCAGTGGTGGCTGG + Intronic
954736847 3:52714522-52714544 CAGGTGTCCGGAGTGGTGGAGGG - Intronic
955391516 3:58525724-58525746 CAGAAGTGAGCAGAGGTGGCTGG + Intronic
956889320 3:73596029-73596051 CACATGTCAGAAGTGGAGCAAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957322213 3:78646147-78646169 AAGCTGTCAGCAGTGGAGGGAGG - Exonic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959295735 3:104531625-104531647 CACATGTCAGCAGGGGTAGCAGG - Intergenic
959460202 3:106616051-106616073 CATATGTGTGCAGTGCTGGATGG + Intergenic
960887620 3:122412593-122412615 CAGCTGTCAGCTGTGGTTGCAGG + Exonic
961333142 3:126154689-126154711 CAGATGTCATCAGGGTGGGAGGG - Intronic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963580017 3:147113867-147113889 CAGTTGGCAGAAGTGGAGGAGGG + Intergenic
964494293 3:157271665-157271687 CTGGTGTCCCCAGTGGTGGAAGG + Intronic
964501618 3:157354386-157354408 AAGCTGTCAGCAGTGCTGGTGGG - Intronic
964662901 3:159140380-159140402 CAGAGATGAGCAGTTGTGGATGG + Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967535125 3:190593326-190593348 AAGAAGTCAGGAGTGGAGGAGGG - Intronic
968095186 3:195924816-195924838 AGGATGTGAGCAGTGGTGGAAGG - Intergenic
968786410 4:2625305-2625327 CAGAGGCCGGCAGTGGTGGGAGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969661177 4:8529130-8529152 CACATGGCAGAAGAGGTGGATGG + Intergenic
970020668 4:11564070-11564092 CATACGTCACCAGTGCTGGAAGG - Intergenic
970270646 4:14343674-14343696 CAGATGTCAGCAGAGGTTGGGGG - Intergenic
970548374 4:17153540-17153562 CAGATTTCATCAGTGGCTGACGG - Intergenic
970575014 4:17418597-17418619 CAGATGTCAGCAGTGGAGCTGGG + Intergenic
973245881 4:48010850-48010872 CAGTGGTGGGCAGTGGTGGACGG + Intronic
973677954 4:53285792-53285814 CAGATATCTGCAGTGGTTGTGGG - Intronic
974002302 4:56523909-56523931 GAGATGTCATCAGTGTTGAATGG + Exonic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976002965 4:80393922-80393944 CACATGTCAAGAGTGGTGGGAGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977919114 4:102624348-102624370 TCGCTGGCAGCAGTGGTGGAGGG - Intergenic
978389794 4:108213545-108213567 CAGATGGTGGCAGTGGGGGATGG + Intergenic
979336682 4:119471520-119471542 TAGATGTCAGCTGTGTTAGATGG + Intergenic
980007378 4:127558511-127558533 GAGGTGTGAGCAGTGGTGGCAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
981654572 4:147098950-147098972 AAGATGTCAGAAGTGGGGAAGGG - Intergenic
981823740 4:148915589-148915611 TGGAGATCAGCAGTGGTGGATGG - Intergenic
982450368 4:155545146-155545168 CAGAGGGCAGCAGTGGTTGCTGG - Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985002501 4:185499896-185499918 CAGATGGGGGCAGTGGGGGATGG + Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
985478226 5:91745-91767 CAGATTTCTGCAGGTGTGGACGG - Intergenic
987072135 5:14347710-14347732 ATGACGTCAGCAGTGCTGGAGGG + Intronic
987572932 5:19688000-19688022 CAGGTGCCAGCAGTGGTGGATGG - Intronic
987717283 5:21588286-21588308 CACATATCACCACTGGTGGAGGG - Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988782146 5:34532153-34532175 CAGCTGTTGGCAGTGGCGGATGG + Intergenic
992341853 5:75832336-75832358 CAGATTTGAGCCGTGGTAGAAGG - Intergenic
993095394 5:83473540-83473562 CATTTGTCAGCTGTGGGGGAGGG - Intronic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
994190563 5:96864561-96864583 CATATTTCAGCTGTGGTAGAAGG + Intronic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996124428 5:119708045-119708067 ATGATGGCAGTAGTGGTGGAGGG + Intergenic
996505190 5:124260801-124260823 CAGAAGTCAGCGGTGGCAGAGGG - Intergenic
996781463 5:127191550-127191572 CAGAAGTCAGCATTAGTGGATGG + Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997284703 5:132669702-132669724 CAGAGGGCAGAAGTGGGGGATGG - Intergenic
997361008 5:133294916-133294938 CAGATTTCACCAGGGCTGGAGGG - Intronic
997411292 5:133692916-133692938 GTGATGTGAGCAGTGGTGCAAGG - Intergenic
1001267661 5:170286402-170286424 CAGGTGTCAGAATTGGTGGCTGG - Intronic
1002667619 5:180837469-180837491 CAGATGTCGGCAGTGAGGGTGGG + Intergenic
1002683535 5:180988971-180988993 CAGATGACAGCAGGGGTGGATGG - Exonic
1003035588 6:2638164-2638186 CAGATGTCCAAGGTGGTGGATGG + Intergenic
1003460794 6:6325847-6325869 CAGTAGTGAGCAGTGGGGGAAGG + Intergenic
1003810357 6:9772958-9772980 CAGAAGTGAGCAGCCGTGGAAGG + Intronic
1003888872 6:10545751-10545773 CAAAAGCCAGCAGTGGAGGAGGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005915652 6:30348394-30348416 AGGAGGTGAGCAGTGGTGGAAGG + Intergenic
1007081614 6:39109188-39109210 TGGAGGTCAGGAGTGGTGGATGG + Intronic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009394092 6:63177317-63177339 CAGTGCTCATCAGTGGTGGATGG - Intergenic
1009519551 6:64664074-64664096 CAGGGATCAGTAGTGGTGGACGG + Intronic
1010987859 6:82446339-82446361 CAGGTGTCAGCAGTGATGGTTGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012037643 6:94163092-94163114 AGGAGGTGAGCAGTGGTGGAGGG - Intergenic
1013415092 6:109917732-109917754 CAGATGAAGGGAGTGGTGGAAGG - Intergenic
1013467609 6:110430953-110430975 AACAGCTCAGCAGTGGTGGAAGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016058677 6:139605388-139605410 GAGATGTCAGCAGAGGTGACAGG + Intergenic
1017882818 6:158573390-158573412 CAGAAGCCAGCAGTGAGGGACGG - Intronic
1019308461 7:347441-347463 TGGAGGTCAGCATTGGTGGAGGG - Intergenic
1019308487 7:347566-347588 GAGAGGTCAGCAATGGCGGAGGG - Intergenic
1019543729 7:1562886-1562908 CAGATGGCGGCAGCTGTGGAAGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021517227 7:21502246-21502268 CAGACATCAGCCGTGGTGTATGG + Intronic
1022210681 7:28206047-28206069 TAGATGACAGGAGTGGAGGAAGG - Intergenic
1022985637 7:35650973-35650995 CAGGTGCCAACAGTTGTGGATGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026440244 7:70437884-70437906 CAGTCTTCAGCAGTGGTAGAAGG + Intronic
1026823909 7:73569231-73569253 CAGATGACAGCTGTGGTGGTGGG + Exonic
1027636353 7:80680198-80680220 CACATGTCTGCAGTGGAGTAGGG + Intergenic
1029093249 7:98065024-98065046 CAGATGTCAGCATGCGGGGAAGG + Intergenic
1030343579 7:108408531-108408553 CATATGTCAGGAGGGGAGGATGG - Intronic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032819157 7:135509258-135509280 AAGATGACAGATGTGGTGGAAGG + Intronic
1034151197 7:148916725-148916747 CAAATGTCCTCAGAGGTGGAGGG + Intergenic
1034595898 7:152191622-152191644 CAGATCACACCAGTGGTGTAAGG + Intronic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035457331 7:159017084-159017106 CTGAGGTCTGCAGTGATGGAAGG - Intergenic
1035457342 7:159017151-159017173 CTGAGGTCTGCAGTGATGGAAGG - Intergenic
1036615327 8:10383156-10383178 CAGATGGCAGCAGAGTTGGCTGG - Intronic
1036619544 8:10415582-10415604 AAGATGGAAGCAGAGGTGGATGG - Intronic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037802790 8:22044335-22044357 CAGCTGTCTGCAGTGGTGGAAGG + Intronic
1038712167 8:29957615-29957637 CAGTTCTCAGCAGTGCTGTATGG - Intergenic
1039711764 8:40062145-40062167 CAGGTGCCAACAGTGGTGGACGG - Intergenic
1039711777 8:40062189-40062211 CAGGTGCCAACAGTGGTGGATGG - Intergenic
1039846210 8:41327298-41327320 GACATGGCAGCAGTGGGGGAGGG - Intergenic
1040942386 8:52846090-52846112 GACATGTAAGCAGTGGGGGATGG + Intergenic
1040967640 8:53100518-53100540 CAGAGTTCAGCACTGGGGGAAGG + Intergenic
1043489036 8:80729509-80729531 CAGGTTTCAGCTGTGGTGGAGGG - Intronic
1044825621 8:96194096-96194118 CAGTTGGCAGGAGAGGTGGATGG + Intergenic
1045027114 8:98098219-98098241 CCTCTGTCCGCAGTGGTGGATGG - Intergenic
1045284700 8:100780320-100780342 CAGATGTCAGCAGTTCCAGAAGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045803674 8:106131091-106131113 CAGAGGTGAGCAGTTGTTGATGG - Intergenic
1046418767 8:113950677-113950699 CAGATGTCTTTAATGGTGGACGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048505839 8:135020526-135020548 GAGAAGTCAGGAGTGTTGGAGGG - Intergenic
1049102392 8:140589038-140589060 CGGACGTCAGCAGAGGTGGGCGG + Intronic
1049787847 8:144459612-144459634 CAGATGCCACCAGTGCTGGCAGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1054590448 9:67005123-67005145 CAGAAGTCAGGAGTGGGGTAGGG + Intergenic
1055371665 9:75606423-75606445 CAGATGGTTGCAGTGGTGGCTGG - Intergenic
1056043777 9:82695506-82695528 CAGATGCCAATGGTGGTGGATGG + Intergenic
1056994853 9:91446158-91446180 CAGATGTCCACAGTGGTGATGGG + Intergenic
1057179559 9:93022406-93022428 CAGCGGTCAGCAGGGGTGAAAGG + Intronic
1057583327 9:96307099-96307121 CAGATGCTCACAGTGGTGGAAGG + Intergenic
1058421245 9:104835363-104835385 CTGAGGTCTGCAGTGGAGGAGGG - Intronic
1058981535 9:110175100-110175122 CAGATGTTAGTAGTGATGGATGG - Intergenic
1059763596 9:117362500-117362522 CACAGGTCAGCAGGGATGGAGGG - Intronic
1060211918 9:121715808-121715830 CAGTTGTCTGCAGAGGTGGGTGG + Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1185676962 X:1857022-1857044 AAGATTTCAACCGTGGTGGAAGG - Intergenic
1186442279 X:9596606-9596628 CGGATGTCACCAGTGGAAGAGGG - Intronic
1187621774 X:21063518-21063540 CAGGTGTCTGCAGTGGTGATGGG + Intergenic
1187856132 X:23637390-23637412 CAGATGCCAACAGTAGTGGAAGG - Intergenic
1188551317 X:31368021-31368043 CCAGTGTCAGCAGTAGTGGACGG + Intronic
1190482465 X:50890397-50890419 TAAATGTCAGCAGTGGTGGCGGG - Intergenic
1191760457 X:64642643-64642665 ATGATGTCAGCAGTTGTGAAGGG + Intergenic
1192094689 X:68198270-68198292 CATATGTCAGAAGAGATGGAAGG - Intronic
1192242979 X:69349467-69349489 CAGATGACCTCACTGGTGGATGG - Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193506507 X:82350174-82350196 CAGATGCCAACAGTAGTGGATGG - Intergenic
1193970088 X:88039800-88039822 CAGATGCCAGCAATGGTGAATGG - Intergenic
1196574841 X:117305407-117305429 CAGGTGCCAACAGCGGTGGATGG - Intergenic
1197594752 X:128451592-128451614 CAGGTGTCAGCAGTGGTAGGTGG + Intergenic
1198969633 X:142266854-142266876 AAGAGGTCAGCAGAGGTGAAAGG - Intergenic
1199535974 X:148903757-148903779 CAGATGTCAGTAGTAGTGCTAGG + Intronic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201450617 Y:14108846-14108868 CAAATGTCAGTAGTGCTGAAGGG + Intergenic
1201680935 Y:16643117-16643139 AAGAGGTCAGCAGAGGTGAAAGG + Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic