ID: 1087757991

View in Genome Browser
Species Human (GRCh38)
Location 11:102074433-102074455
Sequence ACACAAGCACAGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 331}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087757991 Original CRISPR ACACAAGCACAGAAGGAGCT GGG (reversed) Intronic
900207543 1:1438062-1438084 AGCCAAGCCCTGAAGGAGCTGGG + Intronic
900766430 1:4509095-4509117 ACACACACACACAATGAGCTGGG - Intergenic
901199970 1:7461162-7461184 TCACAGGCACAGAAGGCTCTGGG + Intronic
901490236 1:9592944-9592966 ACACAAGCAAGAGAGGAGCTCGG - Intronic
901828247 1:11876592-11876614 AGATAAGCACAGTAGGTGCTGGG - Intergenic
902170307 1:14604798-14604820 ACAGGAGCTCAGATGGAGCTTGG + Intronic
902490118 1:16775387-16775409 TCAGGTGCACAGAAGGAGCTGGG + Intronic
903516690 1:23916006-23916028 AAAGAAGACCAGAAGGAGCTGGG + Intergenic
903726080 1:25446058-25446080 ACACAAGTCCAGAGGGAACTGGG + Intronic
904298283 1:29538076-29538098 ACAAAGGGACAGGAGGAGCTTGG + Intergenic
905395357 1:37663243-37663265 ACACAACCAGGCAAGGAGCTGGG - Intergenic
905922991 1:41731410-41731432 ACCCATGCACAGCAGGTGCTGGG + Intronic
911758792 1:101591950-101591972 ACACAATAAGAGAAGGAGATTGG + Intergenic
912027270 1:105192825-105192847 ACAAAAACACAGATGGTGCTTGG + Intergenic
913532750 1:119744211-119744233 ACAAAAGTGCAGAAGGAGTTGGG - Exonic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918346786 1:183614191-183614213 AGACAAGGACAGAAGGGGTTGGG - Intergenic
918346802 1:183614252-183614274 AGACAAGGACAGAAGGGGTTGGG - Intergenic
918346817 1:183614313-183614335 AGACAAGGACAGAAGGGGTTGGG - Intergenic
918346848 1:183614435-183614457 AGACAAGGACAGAAGGGGTTGGG - Intergenic
918346879 1:183614557-183614579 AGACAAGGACAGAAGGGGTTGGG - Intergenic
919368905 1:196700925-196700947 ACACACACACAGAAGGAAATGGG - Intronic
919534931 1:198775823-198775845 ACTCGAGCACTGCAGGAGCTTGG + Intergenic
919719590 1:200818635-200818657 ACACAATCACAGAATAAACTAGG + Intronic
920543647 1:206798022-206798044 AACCAAACACAGAAGGTGCTGGG - Intergenic
920557244 1:206913162-206913184 AAAGAAGCAGAGAAGGAGCTGGG + Intronic
922218379 1:223539252-223539274 GCACAATCACAGAAGCAGCTTGG - Intronic
922875707 1:228938278-228938300 ACACAAGCAAAGAAAGAGACAGG - Intergenic
923006321 1:230052886-230052908 ACACAAGGACAGGTGGAGCAGGG - Intergenic
923530319 1:234807143-234807165 TCAGGTGCACAGAAGGAGCTGGG - Intergenic
923825531 1:237495489-237495511 ACAAAAACATAGAAGGTGCTTGG - Intronic
924205758 1:241710120-241710142 ACACAAGCAGGGAAGGGGCAGGG - Intronic
924592990 1:245421213-245421235 TCACAAGCACAGAAGCTCCTAGG + Intronic
1063200089 10:3779604-3779626 TCAGAAGCACAGAAGAAGTTAGG + Intronic
1063921837 10:10941162-10941184 AAACAAGAGCAGAAGGAGCTTGG + Intergenic
1065433551 10:25683994-25684016 AGAGAAGCACAAAATGAGCTTGG - Intergenic
1066354682 10:34670834-34670856 ACACAAACAGGGAAGGAACTTGG + Intronic
1069726096 10:70580022-70580044 ACTTAAGCACAAAAGGATCTGGG - Intergenic
1070087012 10:73247294-73247316 TCACAAGCACTGAAGGGGCGTGG + Exonic
1070544930 10:77444836-77444858 ACCCAACCACAGAAGGGACTCGG - Intronic
1070636336 10:78131154-78131176 ACAGAAGCACAGATGTGGCTTGG - Intergenic
1071284447 10:84131653-84131675 ACTCTAACACAGAAGGAGCTAGG - Intergenic
1071892650 10:90028436-90028458 ACTCAGGCACAGAGGGAGCAGGG - Intergenic
1073140156 10:101241997-101242019 ACCCAAGCACAGGAGCAACTTGG + Intergenic
1073225977 10:101919389-101919411 AGCCAAGCAGAGAGGGAGCTGGG - Intronic
1074387320 10:113026991-113027013 ACAAAAGCAGAGAACGAGTTGGG + Intronic
1075467576 10:122663136-122663158 AAACAAGGAGAGAAGGAGGTTGG + Intergenic
1075683721 10:124349835-124349857 ACATAAGAGGAGAAGGAGCTGGG - Intergenic
1075756373 10:124815142-124815164 ACACAAGTACAGAAGCTACTGGG + Intronic
1077522908 11:3046758-3046780 CCACAGCCACAGGAGGAGCTGGG + Intronic
1078052908 11:7983263-7983285 CGACAGTCACAGAAGGAGCTGGG + Intronic
1078353714 11:10617330-10617352 CCACAAATACAGAAGGAGCAAGG + Intronic
1080141842 11:28931077-28931099 ACTCAAACACAGAGGGAGATGGG - Intergenic
1080599283 11:33806915-33806937 ACAGAAGGTTAGAAGGAGCTTGG + Intergenic
1084046940 11:66574516-66574538 AGACAAGGAGAGAAGGGGCTGGG - Intergenic
1084589624 11:70083153-70083175 ACACACGCACATAAAGAACTAGG - Intronic
1087220166 11:95538537-95538559 ACAAAAGCACAGAAGGAAGAAGG - Intergenic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1087904747 11:103682559-103682581 CAAGAAGCACGGAAGGAGCTGGG + Intergenic
1091547384 12:1510493-1510515 ACAAAAGCAGAGAAGGAACAAGG + Intergenic
1091886348 12:4019697-4019719 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1092041220 12:5386298-5386320 ACAGAAACACAGAACGAGCCAGG + Intergenic
1093177565 12:15929572-15929594 ACACACACACAGAAGAAGCTTGG - Intronic
1093324117 12:17752395-17752417 ACAGAAGCACAGAAGGATAATGG - Intergenic
1093421433 12:18978873-18978895 ATGCAAGCACAAAAGGAGATAGG - Intergenic
1093748550 12:22771946-22771968 TCACAAACACAGAAGGAACCTGG + Intergenic
1095405924 12:41867189-41867211 AAACAATCACAGAGGGAGCCTGG - Intergenic
1096718922 12:53506983-53507005 ACACAAGCATGGCAGGGGCTGGG - Intronic
1096726662 12:53569262-53569284 ACAGAAGAACAGCAGCAGCTGGG + Intronic
1097594346 12:61609950-61609972 CCACAAGGAAAGAAGGAACTGGG - Intergenic
1097724650 12:63061266-63061288 ACACAAGAAGAGACAGAGCTAGG - Intergenic
1097951139 12:65429342-65429364 ATACAACCACACAAAGAGCTTGG + Intronic
1098307652 12:69117666-69117688 ACAGAAGCACAGCAGGCCCTTGG + Intergenic
1099188486 12:79540776-79540798 AGACAAGGAGAGAAGGAGTTGGG - Intergenic
1100669560 12:96795745-96795767 ACACAAGCACAGAAGTAGAGGGG - Intronic
1104124187 12:125829816-125829838 CCACAAGAATACAAGGAGCTAGG - Intergenic
1104980584 12:132571612-132571634 ACACCAGCCCAGGAGGAGGTGGG + Intronic
1107921249 13:45210465-45210487 ATACAAGTACAGAAAGAGGTAGG - Intronic
1108103403 13:46982707-46982729 ACAAAAGCTCAGAGGTAGCTGGG - Intergenic
1108280585 13:48857184-48857206 ACACACACACAAAAGGGGCTGGG + Intergenic
1108473269 13:50788378-50788400 ACACACGCACAGGAGGGTCTGGG - Intronic
1108509915 13:51147318-51147340 TCACAGGCACGGAGGGAGCTAGG - Intergenic
1109709875 13:66146093-66146115 AGACAAGGAGAGAAGGAGTTTGG + Intergenic
1111114856 13:83762006-83762028 ACACAAGCAGAAGAGGAGTTTGG + Intergenic
1112018560 13:95351858-95351880 ACACAAGAAAAGAGGGAGCGTGG + Intergenic
1112787542 13:102967880-102967902 ACACAATCACTGAAGGAATTAGG + Intergenic
1113035258 13:106040842-106040864 ACACACTCACAGAAGACGCTGGG - Intergenic
1113499374 13:110761095-110761117 TCACAAGCAGAGATGGAGCAAGG - Intergenic
1114350458 14:21844751-21844773 ACACAAATACAGAAGCAGGTTGG + Intergenic
1114354517 14:21892562-21892584 ACACAAGTACAGAAGCAGGATGG + Intergenic
1115615069 14:35086791-35086813 ACACAAAAAAAGAAGGGGCTGGG - Intronic
1115738294 14:36359100-36359122 GAACCAGCAAAGAAGGAGCTTGG + Intergenic
1117625396 14:57632318-57632340 ACACAAGCATAAAATAAGCTGGG - Intronic
1117804582 14:59478421-59478443 ACACAAACACAGATTTAGCTGGG + Intronic
1119676876 14:76562453-76562475 AAACAAACAAAGAAGGAACTTGG + Intergenic
1120314419 14:82872882-82872904 ACACAAGAAGAGGAGGAGCCAGG - Intergenic
1121490220 14:94353154-94353176 ACAAAAGTATAGTAGGAGCTTGG - Intergenic
1121619862 14:95338653-95338675 ACAGGAGCACAGAGAGAGCTGGG - Intergenic
1122547575 14:102532666-102532688 AGACAAGAACAGAAGCTGCTTGG + Intergenic
1122859690 14:104577051-104577073 TCACTACCACAGAGGGAGCTGGG + Intronic
1122862016 14:104586962-104586984 CCACAGGCACAGCAGGAGCTGGG + Intronic
1124391845 15:29266374-29266396 ACACAAGCTCAAGAGCAGCTTGG + Intronic
1124581332 15:30957895-30957917 ACACAGGCAGAGGTGGAGCTGGG + Intronic
1128221440 15:65971512-65971534 ACACAGGCACAGATGAAGGTGGG + Intronic
1128886482 15:71293031-71293053 ACACAAACACAAAAAGAACTTGG - Intronic
1129367642 15:75066319-75066341 GCTCAAGCACAGAAGGAGGGGGG - Intronic
1129518999 15:76174029-76174051 ACAGAAAAACAGAAGGAGCCTGG - Intronic
1130112677 15:80978873-80978895 ACCCAATCACAGCAGGTGCTTGG + Exonic
1131424228 15:92332329-92332351 ACAGAAGCACAGAATGACATAGG - Intergenic
1131690268 15:94819900-94819922 ACACAAGGACACAAGGGCCTCGG - Intergenic
1133769663 16:8860381-8860403 TCAAAAGCACAGCAGCAGCTAGG - Intronic
1133869842 16:9676311-9676333 AGACAAGGAGAGAAGGAGTTTGG + Intronic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135511568 16:23089152-23089174 ACACAAGACTAGGAGGAGCTTGG - Intronic
1138648362 16:58441858-58441880 ACTCAGGCACAGAGGGAGGTAGG + Intergenic
1138820848 16:60257672-60257694 ACAAAATGACAGAAGGAACTCGG - Intergenic
1139379518 16:66521679-66521701 AGACAGACACAGGAGGAGCTGGG - Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1140957423 16:79878162-79878184 TCAGAAGGACAGAAGGAGCCAGG + Intergenic
1146496858 17:33330312-33330334 TGAGAAGCACAGAATGAGCTGGG - Intronic
1149470041 17:56909041-56909063 ACACAGGAACAGAACGAGCTGGG + Intronic
1149530315 17:57389882-57389904 ACAGAAGAGCAGAAGGAGCCTGG - Intronic
1150998401 17:70345788-70345810 TCACAAGCAGAGAAGGGACTTGG + Intergenic
1154078344 18:11228107-11228129 ACACACACACAGCAGGAGGTGGG + Intergenic
1156248302 18:35325064-35325086 AAACAAGACCAGAAGGAGCCTGG + Intergenic
1156260384 18:35440457-35440479 AGACAAGCAAAGAACGGGCTGGG - Intergenic
1156520801 18:37720997-37721019 ACTCAAGCACAGATGCTGCTTGG + Intergenic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156603526 18:38638967-38638989 ACAAAAGCAAAGAAGGATATAGG + Intergenic
1157822574 18:50784496-50784518 ACACACACACAGAAGGGGCATGG + Intergenic
1158007560 18:52690599-52690621 ACACAAGAACCAAAGGAGATTGG + Intronic
1158208751 18:55023328-55023350 ACACAAGCACTGAAGTGGCAAGG + Intergenic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1158715303 18:59873782-59873804 CCAGATGCACAGAAGAAGCTTGG - Intergenic
1164462062 19:28457438-28457460 ACACAGGCAGAGAAGAAGCTTGG + Intergenic
1164838169 19:31372045-31372067 ACACAAGCACATACGCAGCCAGG - Intergenic
1164887544 19:31795209-31795231 ACACAATCAGATAAAGAGCTGGG - Intergenic
1166342864 19:42149253-42149275 ACACTCGCAGAGATGGAGCTGGG - Intronic
1166561587 19:43736276-43736298 ACACATGCCCAGTAAGAGCTAGG + Intronic
1167527645 19:49994927-49994949 ACACAAGCACCCCAGGAGGTGGG + Intronic
1168358180 19:55715387-55715409 ACTCAAGAAAATAAGGAGCTGGG + Intronic
925079752 2:1054487-1054509 ACAAAACCACAGTAGGAGCTTGG - Intronic
925283183 2:2699096-2699118 ACAGGAGCACGGAAGGAGGTGGG + Intergenic
925325256 2:3014619-3014641 ACACTAACACAGTAAGAGCTGGG + Intergenic
925711906 2:6749447-6749469 CTACAACCACAGAAGGAGATGGG + Intergenic
925753879 2:7115045-7115067 ACCCAAGGAAAGAAGGAGGTTGG + Intergenic
926002177 2:9342452-9342474 CCACAAGCAAAGAAGGAACTTGG + Intronic
926485919 2:13458012-13458034 ACAGAAGCAGAGAAGAAGCATGG - Intergenic
926672700 2:15590908-15590930 ACACACACACAGAAGAAGCCGGG - Intergenic
927219609 2:20694993-20695015 ACAGAAACACAGAAGGAGACTGG - Intronic
927909228 2:26884867-26884889 ACACAAGTACAGATCAAGCTTGG - Intronic
928193707 2:29197265-29197287 ACACATTCCCAGCAGGAGCTTGG + Intronic
928418135 2:31113799-31113821 ACTCAGGCACAGAGGGAGGTGGG + Intronic
929255430 2:39806088-39806110 ACACACGCACAGAAATACCTAGG - Intergenic
929378965 2:41326589-41326611 TCAGAAGCCCAGAAGTAGCTAGG + Intergenic
929748902 2:44689500-44689522 ACTCAAGCACAGCAGGGCCTTGG + Intronic
929862571 2:45692355-45692377 ACACAAGCCCAGGAGTACCTGGG - Intronic
930605970 2:53493353-53493375 AGACAAGAACAGATGGAGCAGGG + Intergenic
930775264 2:55164501-55164523 ACACGCGCTTAGAAGGAGCTCGG - Intergenic
931052678 2:58431416-58431438 ACACAAGAACAGATTGAGTTTGG - Intergenic
931988864 2:67769117-67769139 CCACCAGCCCAGAAGGAGCAGGG + Intergenic
932088342 2:68782273-68782295 CCACAAACCCAGAAGAAGCTGGG + Exonic
933569303 2:83990765-83990787 AGATAATCACAAAAGGAGCTTGG - Intergenic
934057640 2:88265473-88265495 ACACACACACACACGGAGCTTGG - Intergenic
935391415 2:102557176-102557198 ACACATGCACAGAAGGAGTTTGG - Intergenic
936819340 2:116499878-116499900 ACACAATCCCAGAAGGAACATGG - Intergenic
937851399 2:126639446-126639468 GCAGAAGCACAGAGGGAGGTTGG - Intergenic
938602404 2:132855610-132855632 ACACAAACTAAGAAGGAGTTGGG - Intronic
940219435 2:151336270-151336292 ACAAAAGAACAAAAGGAGTTTGG + Intergenic
940877417 2:158911910-158911932 ACAGAAGGACAGAAGAATCTAGG - Intergenic
941491565 2:166148494-166148516 ACACTAGCACTGAAGGAGGGTGG - Intergenic
942605237 2:177683567-177683589 ACACAGGAACAGAAGGGGCCAGG - Intronic
946212448 2:218158095-218158117 ACACATGCACAAAATTAGCTGGG - Intergenic
946325577 2:218983114-218983136 ACACAAAGACAGGAGGAGGTTGG - Intronic
946418158 2:219550917-219550939 ACACCAGTACACAAAGAGCTGGG + Intronic
946548874 2:220778135-220778157 AGACAAGCACAGAAATGGCTGGG + Intergenic
947747489 2:232516469-232516491 ACAAAAGCACAGTAGGAACCTGG - Intergenic
948032426 2:234829856-234829878 ACAAAATTACAGAAGAAGCTTGG - Intergenic
948536631 2:238651883-238651905 ACAAAAGGAGAGGAGGAGCTGGG + Intergenic
1169051160 20:2578992-2579014 GCTCAAGGACAGCAGGAGCTGGG + Intronic
1169163148 20:3399776-3399798 ACACAAACACAGAAGAGGCCTGG + Intronic
1169316452 20:4594430-4594452 ACAGAAGGACACAAAGAGCTTGG + Intergenic
1170339731 20:15310753-15310775 AGTCAAGCAGAGAAGGGGCTTGG + Intronic
1173338948 20:42136923-42136945 ACCTAAGCAGAGAGGGAGCTGGG + Intronic
1174048280 20:47749158-47749180 AGAAAGGCAGAGAAGGAGCTTGG + Intronic
1174892124 20:54406718-54406740 GCACAAGCACAGAAAAAGGTAGG + Intergenic
1175089589 20:56490964-56490986 CCACCATCACAGAAGGTGCTAGG + Intronic
1175413197 20:58784934-58784956 AGAGCAGCACAGCAGGAGCTTGG + Intergenic
1175575072 20:60054994-60055016 ACACAAACACACAAACAGCTTGG + Intergenic
1176518729 21:7808337-7808359 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1178652757 21:34438350-34438372 AAACAAGCAGACAAGGGGCTGGG + Intergenic
1178809788 21:35871147-35871169 ACACAAGCATGGAAGGGCCTAGG - Intronic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1179472662 21:41621900-41621922 TCACAAGCACACCAGGAACTCGG + Intergenic
1179813468 21:43887143-43887165 GCAAAAACAGAGAAGGAGCTGGG - Intronic
1181083640 22:20429411-20429433 AGCCAAGCACAGAAGGGGCGGGG + Intronic
1181617927 22:24067639-24067661 ACAGAAGCACAGAAGGATTCAGG - Intronic
1183833816 22:40435510-40435532 TCATGAGCAGAGAAGGAGCTTGG - Exonic
950191716 3:10981219-10981241 ACTCAAGGAGAGAGGGAGCTGGG - Intergenic
950668857 3:14513397-14513419 ACCCATGCTGAGAAGGAGCTTGG + Intronic
951074713 3:18375994-18376016 ACACCATCACAGAAGATGCTTGG + Intronic
952861633 3:37817561-37817583 ACCCAAGGAGAGAGGGAGCTGGG + Intronic
953200645 3:40775700-40775722 ACACAAAGACAGAAGGACTTGGG + Intergenic
953767075 3:45751632-45751654 ACATAAGCACAAAATGTGCTAGG - Intergenic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954166429 3:48762472-48762494 ACACATGCACAAAATTAGCTGGG + Intronic
958597486 3:96246269-96246291 ACTAAAGAACAGAAGGTGCTAGG - Intergenic
958692413 3:97484748-97484770 AGCCAAGAACAGAAGGAACTTGG - Intronic
959521610 3:107328248-107328270 ACACAACTACAGAAGGAAGTTGG - Intergenic
960034187 3:113086520-113086542 ACACAAATCCAGCAGGAGCTGGG + Intergenic
960152208 3:114261901-114261923 ACACATGCACAGAGGGAGGGAGG + Intergenic
961516954 3:127443983-127444005 ACACAAGCAGCGAATGAGCTTGG - Intergenic
961783294 3:129334186-129334208 ACACCTGCACATCAGGAGCTGGG - Intergenic
962432033 3:135328840-135328862 GCAGATGCACAGAAGGAGCCTGG + Intergenic
962828829 3:139122063-139122085 ACACTAACAGAGAAGGAGCTGGG - Intronic
963232919 3:142927030-142927052 ACTCAACCACAGGAGGATCTGGG + Intergenic
963369387 3:144379111-144379133 ACAAAAACACAGAAATAGCTTGG + Intergenic
963684081 3:148415172-148415194 AGACAAGCAGAGAAGGGGTTGGG - Intergenic
964766852 3:160187704-160187726 ACAGACACACAGAAAGAGCTGGG + Intergenic
965063342 3:163809712-163809734 GCTCAAGCACAGAAGGAGAGGGG + Intergenic
966402567 3:179562764-179562786 ACAGCAGGACAGAAGGAGTTGGG - Intergenic
966567564 3:181400150-181400172 ACACGATTGCAGAAGGAGCTCGG - Intergenic
966811624 3:183851094-183851116 CCATAAGCACAGAATGAGTTTGG + Intronic
967010929 3:185432840-185432862 ACACAGGCACAGCAGGTGCCTGG + Intronic
970467275 4:16337406-16337428 ACACAACCACAGTGGGTGCTGGG - Intergenic
970977770 4:22060523-22060545 ACAGAAAAACAGAAGGAGCTGGG - Intergenic
971110593 4:23580960-23580982 AAACTAGCACAAAAGGAGCTTGG + Intergenic
971256883 4:25022545-25022567 ACACAAACACAGAGGGAGCGAGG - Intronic
972204656 4:36757691-36757713 ACACAGGCAGAGCAGCAGCTTGG + Intergenic
972707687 4:41561132-41561154 ACACAAGGTCAGAAAGAGCCTGG - Intronic
973272502 4:48276003-48276025 ACAAAAAGACAGAAGGAGCTGGG - Intergenic
973971251 4:56216038-56216060 AGACAAGCAAGGGAGGAGCTGGG - Intronic
974673483 4:65061017-65061039 ACACAAGTCCAGAAAGAGATGGG - Intergenic
975251892 4:72189900-72189922 ACACAAGGAAAGAAGCAGCAGGG - Intergenic
975810943 4:78168939-78168961 ACAGAAGAAAAGAAGGAACTGGG + Intronic
975865342 4:78718772-78718794 ACACAAGGAGAGAAGGGGTTGGG + Intergenic
976317623 4:83675724-83675746 ACAGAAACAAAGAAAGAGCTAGG + Intergenic
976385033 4:84447294-84447316 ACACTAGCACACAAAGAGCTGGG + Intergenic
979379654 4:119994600-119994622 AGACAAGGAGAGAAGGAGTTGGG - Intergenic
979866919 4:125767652-125767674 CAACAAGCACAAAATGAGCTTGG + Intergenic
980427442 4:132644752-132644774 ACAGTAGCAGAGAGGGAGCTAGG - Intergenic
981453699 4:144929338-144929360 ACACAAGCACAAAAATACCTAGG - Intergenic
982398818 4:154943252-154943274 TCAAAAGCACAGAAGGTTCTGGG - Intergenic
984870478 4:184320340-184320362 ACACATGCACATATGGACCTAGG + Intergenic
985148114 4:186915712-186915734 ACACAAACCCAGAAGCAGGTTGG - Intergenic
985384318 4:189429380-189429402 GCACAAGCACAGACGGGCCTCGG + Intergenic
985390138 4:189484456-189484478 AGACAAGGACAGAAGGGGTTGGG + Intergenic
986029350 5:3880874-3880896 ACAGAGGCACAGCTGGAGCTCGG + Intergenic
986377649 5:7148628-7148650 ACACAAGCACCTAAGGAGGTGGG + Intergenic
986825120 5:11512044-11512066 ACAGAAACACAGAAGGATCCTGG + Intronic
988289302 5:29265284-29265306 ACACCTGAACAGAAGTAGCTTGG - Intergenic
990517767 5:56546267-56546289 ACACACACAAAGAAGGAACTGGG - Intronic
994247810 5:97500383-97500405 ACAATAGGACAAAAGGAGCTTGG + Intergenic
994289734 5:98014620-98014642 ACACAGGCACACAGGCAGCTGGG + Intergenic
995710743 5:115033022-115033044 ACACATGCACATAAGGAGTATGG + Intergenic
996534258 5:124560594-124560616 ACACAAACACAAAAGGAGAGTGG + Intergenic
996933353 5:128917928-128917950 ACAGATGCACAGAAGAAGCAAGG - Intronic
997673611 5:135696111-135696133 ACACATGCACAGAAAGTGCCTGG + Intergenic
998591311 5:143481634-143481656 ACAGAAACACAGAATGAGATCGG + Intergenic
998979987 5:147691359-147691381 TCACAGTAACAGAAGGAGCTGGG - Intronic
998992353 5:147831860-147831882 CCACAACCACAGAGGGAGTTAGG - Intergenic
999133917 5:149304868-149304890 ACAGATGCACAGGAGGGGCTAGG + Intronic
999191368 5:149749947-149749969 ACAGATGGACAGATGGAGCTAGG + Intronic
999315578 5:150581932-150581954 ACAGAAGAAAAGAAAGAGCTTGG + Intergenic
1000748611 5:165066697-165066719 ACCCAGGCACAGAACTAGCTTGG - Intergenic
1002348424 5:178564232-178564254 ACAAAAGCACAAAAGGAGTTAGG - Intronic
1003563487 6:7203037-7203059 AGACAAGCACAGGAGGATGTAGG + Intronic
1004278638 6:14259683-14259705 ACATAACCAAAGAAGGGGCTGGG - Intergenic
1006007050 6:31010820-31010842 ACATAAGCCCTGAAGGAGATGGG + Intronic
1007240809 6:40423888-40423910 ACAGAAAGACAGAAGGAACTGGG + Intronic
1007337862 6:41167603-41167625 ACAGAATCAAAGAAGGAACTGGG - Intergenic
1009783198 6:68296824-68296846 ACACATGGACACAAGGAGGTGGG + Intergenic
1009928747 6:70150894-70150916 AGACAAACACTGAAGGAACTTGG - Intronic
1010183387 6:73114664-73114686 AGACAAGCCTAGGAGGAGCTAGG + Intronic
1010894700 6:81349644-81349666 AGAAAAGCACAGAAGGGGTTGGG + Intergenic
1011262473 6:85483769-85483791 AGAGAAGCCCAGAAAGAGCTTGG + Intronic
1013491026 6:110646478-110646500 ACGCTGGCACAGAACGAGCTGGG - Intronic
1013668774 6:112375608-112375630 ACACAAGGACAGAAGGAATTTGG + Intergenic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1017134025 6:151132640-151132662 ACACACGCAAAGAAGAAGCCAGG + Intergenic
1018106397 6:160491377-160491399 ACACCAGCACAGTAGGACCCCGG - Intergenic
1018653133 6:166007820-166007842 ACCCCAGCAAAGAAGGAGCCAGG + Intergenic
1019276325 7:177855-177877 ACAGGAGCACAGAGGGAGCCTGG - Intergenic
1019657216 7:2202279-2202301 ACTCAGCCACAGGAGGAGCTGGG + Intronic
1020398882 7:7751619-7751641 GCTCAAGCCCAGGAGGAGCTGGG - Intronic
1021248709 7:18296880-18296902 ACAGAATCACAGAAGGAGGCAGG + Intronic
1022185025 7:27958861-27958883 AGACAAGCAGGGAAGGAGCTGGG + Intronic
1022372669 7:29785878-29785900 AGACATGGAGAGAAGGAGCTGGG - Intergenic
1022850091 7:34252084-34252106 TCACAAGCACAGGAGGAACGTGG - Intergenic
1023944741 7:44794839-44794861 ACACACACACAAAATGAGCTGGG + Intergenic
1023992035 7:45134236-45134258 ACACAAGGACGCAAGGAGCATGG + Intergenic
1027221539 7:76217240-76217262 ACACACACACAGAAAGAGCACGG + Intronic
1028090396 7:86693384-86693406 ACACAAACATAGCAGGAGATAGG + Intronic
1029258367 7:99284704-99284726 ACAGAAGGCCAGAAGGGGCTGGG + Intergenic
1029745685 7:102514622-102514644 ACACTAGCGAAGAAGGAACTGGG - Intronic
1029763624 7:102613601-102613623 ACACTAGCGAAGAAGGAACTGGG - Intronic
1030288993 7:107853940-107853962 ACAAACGCAGAGAAGGACCTGGG + Intergenic
1031469729 7:122154888-122154910 GCACAAGCAAAGAATGAACTTGG + Intergenic
1031589602 7:123573488-123573510 CCTCAAGCAAAGAAGCAGCTCGG + Intronic
1033109735 7:138563415-138563437 ACACGGGCACAGACGGAGATGGG - Intronic
1033322814 7:140355679-140355701 ACTGAAGAACAGAAGAAGCTAGG + Exonic
1034659421 7:152756675-152756697 ACACAAGAAGAGAAGCAGCTGGG + Intergenic
1035275393 7:157745240-157745262 AGACATACACAGAAGGACCTGGG - Intronic
1038391798 8:27208748-27208770 GCATAAGCACAGAAGGATCTAGG + Intergenic
1039702350 8:39974946-39974968 ACAAAAGCACAAAATTAGCTGGG + Intronic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041366795 8:57114881-57114903 ACACAAGCACTGAGGGAATTTGG + Intergenic
1041548739 8:59077069-59077091 ACACAAGGAGTGCAGGAGCTGGG - Intronic
1041975670 8:63796525-63796547 ACAAAAGCTCAAAAGGAGCATGG + Intergenic
1041995928 8:64057964-64057986 ACACAAACACACAATCAGCTAGG - Intergenic
1042215465 8:66426598-66426620 ACACATGCACACAAAGAGCCAGG + Intergenic
1043394429 8:79822902-79822924 ACACATGCACTGAGGGGGCTGGG + Intergenic
1043664662 8:82793649-82793671 AGACAAGAACAGAAAGACCTAGG + Intergenic
1045566969 8:103328368-103328390 AGACATGCACAGAATGGGCTGGG + Exonic
1047350543 8:124069278-124069300 GCAAAAGGAAAGAAGGAGCTTGG + Intronic
1048381481 8:133869700-133869722 ACACAAGCACTGAACGAGCCTGG - Intergenic
1048420737 8:134275820-134275842 AAAAAAGAAGAGAAGGAGCTAGG - Intergenic
1048724013 8:137360978-137361000 ACACACGCACACAAATAGCTAGG + Intergenic
1048745497 8:137610426-137610448 AGGCAATGACAGAAGGAGCTGGG - Intergenic
1050125606 9:2353677-2353699 AAACAAGCACACAAGGAGAAAGG - Intergenic
1051260098 9:15255453-15255475 ACACAAGCAATGAAGAAGTTTGG + Intronic
1053209462 9:36215530-36215552 GCAAAAGCACAGAGGGACCTGGG + Exonic
1053417107 9:37953679-37953701 ACCCTAGCACAGAGGGAGGTAGG - Intronic
1054860397 9:69946957-69946979 ACACAAGCACAGGAAGAGCTGGG - Intergenic
1055133409 9:72801743-72801765 TGACAAGCACACAAGGAACTAGG + Intronic
1056060933 9:82884672-82884694 AGACAAGGACAGAAGGGGTTGGG - Intergenic
1056323602 9:85459323-85459345 AGACAAGGAGAGAAGGGGCTGGG - Intergenic
1056703622 9:88932886-88932908 ACACAAGAACAGGAGAAGCCAGG + Intergenic
1056721910 9:89079631-89079653 AAAGTAGCACAGAAGCAGCTGGG - Intronic
1056746065 9:89304138-89304160 GCTCAGGCACAGAAGGAGGTTGG + Intergenic
1057719582 9:97521088-97521110 ACACAAGGACAGGACCAGCTGGG - Intronic
1058968318 9:110057351-110057373 AAAAAAACAGAGAAGGAGCTGGG - Intronic
1059015402 9:110510323-110510345 ACACAATTTTAGAAGGAGCTTGG - Intronic
1059160499 9:112030337-112030359 ACTCCATCACTGAAGGAGCTGGG + Intergenic
1059496811 9:114717023-114717045 TCAAAAGTACAGAAGGGGCTAGG - Intergenic
1059574352 9:115474121-115474143 AGACAAGGACAGAAGGGGTTGGG - Intergenic
1059620259 9:115997051-115997073 GGCCACGCACAGAAGGAGCTTGG + Intergenic
1060624223 9:125095829-125095851 ACAAAAGAATAGAAGGAGCCTGG + Intronic
1060720570 9:125974231-125974253 ACAAAGGCACAGCCGGAGCTGGG + Intergenic
1060964501 9:127705211-127705233 ACACAAACCCTGCAGGAGCTGGG - Intronic
1061735089 9:132649468-132649490 ACAAAAAGACAGAAAGAGCTTGG + Intronic
1062161360 9:135082007-135082029 ACACGAGCACAGAAGAAGCAGGG - Intronic
1062237383 9:135516790-135516812 AGACAAGCACAGAGGGTGCAGGG - Intergenic
1186075652 X:5875305-5875327 CCACAAGCCTGGAAGGAGCTAGG + Intronic
1186246222 X:7619501-7619523 ACACAAACACAGATGGGGGTGGG + Intergenic
1186506400 X:10096463-10096485 ACACAAGCACAAAGTGAGGTAGG - Intronic
1186926021 X:14334459-14334481 ACACAAGGCCAGAAGGAGGGAGG - Intergenic
1187100514 X:16186571-16186593 ACCCAAGGAGAGAGGGAGCTGGG + Intergenic
1187185268 X:16978470-16978492 ACAAGGGCACAGAAGGAGCATGG - Intronic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1190157503 X:48005771-48005793 GCAACAGCACAGAAGGAGCCAGG + Intronic
1190173273 X:48128656-48128678 GCAACAGCACAGAAGGAGCCAGG + Intergenic
1190259470 X:48789008-48789030 ACAAAAGCACAGAAAGAGGTCGG + Intronic
1190898806 X:54648778-54648800 AGTCCAACACAGAAGGAGCTTGG - Intergenic
1191663549 X:63674792-63674814 GCTCAGGCACAGAAGGAGGTAGG - Intronic
1193837200 X:86358477-86358499 ACACAATCCCAGAGAGAGCTGGG + Intronic
1194351123 X:92825663-92825685 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic
1194831454 X:98627567-98627589 ACACAAGTACAGAAGGAATACGG + Intergenic
1196799666 X:119531296-119531318 ACACCAGCCCAGCAGGAGCTTGG - Intergenic
1197698383 X:129575699-129575721 ACACCAGCAGAGAAGGAGTTAGG - Intronic
1198053690 X:132973279-132973301 GCACAAGCACAGTAGGAGCTGGG - Intergenic
1198173180 X:134128053-134128075 ACCCAAGCACAGAAATAGCTGGG + Intergenic
1198986206 X:142456881-142456903 ACACATGCACAGAGGTAGATAGG + Intergenic
1199335601 X:146615776-146615798 ACTCTAGCACAGAAGGAGAGGGG - Intergenic
1199696490 X:150346202-150346224 ACACAAAGACAGCAGAAGCTTGG - Intergenic
1200659449 Y:5942343-5942365 AGAAAAGCAGAGAAGGAGTTGGG - Intergenic