ID: 1087761710

View in Genome Browser
Species Human (GRCh38)
Location 11:102110234-102110256
Sequence GCGAGCGGGTCACGTGCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087761693_1087761710 20 Left 1087761693 11:102110191-102110213 CCCCTGCCCGGCTGAGCGCGGGC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 271
1087761694_1087761710 19 Left 1087761694 11:102110192-102110214 CCCTGCCCGGCTGAGCGCGGGCG 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 271
1087761699_1087761710 13 Left 1087761699 11:102110198-102110220 CCGGCTGAGCGCGGGCGAAGGGC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 271
1087761695_1087761710 18 Left 1087761695 11:102110193-102110215 CCTGCCCGGCTGAGCGCGGGCGA 0: 1
1: 0
2: 3
3: 11
4: 112
Right 1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 271
1087761697_1087761710 14 Left 1087761697 11:102110197-102110219 CCCGGCTGAGCGCGGGCGAAGGG 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1087761710 11:102110234-102110256 GCGAGCGGGTCACGTGCGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087761710 Original CRISPR GCGAGCGGGTCACGTGCGGC CGG Intergenic