ID: 1087761745

View in Genome Browser
Species Human (GRCh38)
Location 11:102110376-102110398
Sequence AGGCGGGGCCGCGGCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1259
Summary {0: 1, 1: 1, 2: 17, 3: 175, 4: 1065}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087761732_1087761745 25 Left 1087761732 11:102110328-102110350 CCGGGCCGCGGTGCGGGCGGGCG 0: 1
1: 1
2: 5
3: 51
4: 326
Right 1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG 0: 1
1: 1
2: 17
3: 175
4: 1065
1087761733_1087761745 20 Left 1087761733 11:102110333-102110355 CCGCGGTGCGGGCGGGCGCGCAG 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG 0: 1
1: 1
2: 17
3: 175
4: 1065
1087761729_1087761745 29 Left 1087761729 11:102110324-102110346 CCGGCCGGGCCGCGGTGCGGGCG 0: 1
1: 0
2: 1
3: 30
4: 240
Right 1087761745 11:102110376-102110398 AGGCGGGGCCGCGGCGGCGCGGG 0: 1
1: 1
2: 17
3: 175
4: 1065

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087761745 Original CRISPR AGGCGGGGCCGCGGCGGCGC GGG Intergenic