ID: 1087761762

View in Genome Browser
Species Human (GRCh38)
Location 11:102110469-102110491
Sequence CAGGGAAAAGAAAGGGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3690
Summary {0: 1, 1: 2, 2: 34, 3: 431, 4: 3222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087761762 Original CRISPR CAGGGAAAAGAAAGGGAGGA AGG Exonic
Too many off-targets to display for this crispr