ID: 1087766801

View in Genome Browser
Species Human (GRCh38)
Location 11:102164147-102164169
Sequence CGCGCCTCAGCCTCCCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6816
Summary {0: 1, 1: 0, 2: 151, 3: 1729, 4: 4935}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087766800_1087766801 -5 Left 1087766800 11:102164129-102164151 CCAGGTTCAAGTGATTCTCGCGC 0: 12
1: 1858
2: 44109
3: 95846
4: 115373
Right 1087766801 11:102164147-102164169 CGCGCCTCAGCCTCCCGAGCTGG 0: 1
1: 0
2: 151
3: 1729
4: 4935
1087766799_1087766801 -4 Left 1087766799 11:102164128-102164150 CCCAGGTTCAAGTGATTCTCGCG 0: 8
1: 1230
2: 28607
3: 101615
4: 169392
Right 1087766801 11:102164147-102164169 CGCGCCTCAGCCTCCCGAGCTGG 0: 1
1: 0
2: 151
3: 1729
4: 4935
1087766797_1087766801 5 Left 1087766797 11:102164119-102164141 CCTCTGCCTCCCAGGTTCAAGTG 0: 8512
1: 31147
2: 73419
3: 112634
4: 127542
Right 1087766801 11:102164147-102164169 CGCGCCTCAGCCTCCCGAGCTGG 0: 1
1: 0
2: 151
3: 1729
4: 4935
1087766798_1087766801 -1 Left 1087766798 11:102164125-102164147 CCTCCCAGGTTCAAGTGATTCTC 0: 20599
1: 62494
2: 120157
3: 154110
4: 162194
Right 1087766801 11:102164147-102164169 CGCGCCTCAGCCTCCCGAGCTGG 0: 1
1: 0
2: 151
3: 1729
4: 4935

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087766801 Original CRISPR CGCGCCTCAGCCTCCCGAGC TGG Intronic