ID: 1087768281

View in Genome Browser
Species Human (GRCh38)
Location 11:102179870-102179892
Sequence TCATTTAAACTGAAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 356}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087768281 Original CRISPR TCATTTAAACTGAAGGGACA GGG (reversed) Intronic
902596625 1:17514218-17514240 TCATTTAAACTCAAGAGGCGGGG - Intergenic
902969382 1:20035584-20035606 TCACTTAAACTTAAGGTATAGGG - Intronic
906001430 1:42429532-42429554 TGATTTTACCTGAAGGGGCAGGG + Intergenic
907630063 1:56071947-56071969 TCATTTCAAATTAAAGGACAAGG + Intergenic
908881743 1:68740576-68740598 TAATTTAGATTGGAGGGACAGGG - Intergenic
909042048 1:70666343-70666365 TCTTTTAAAGTTAAGGGGCAGGG - Intergenic
910828941 1:91440359-91440381 TAATTGTAACTCAAGGGACAAGG - Intergenic
911947659 1:104133071-104133093 ACATTTAATCTTAAGGGGCATGG + Intergenic
912782423 1:112564205-112564227 TGACTTATACTGAAGGGAAAAGG + Intronic
916646742 1:166794124-166794146 AGATTTAAACTGTAGAGACATGG - Intergenic
916868921 1:168890734-168890756 TCATATAAACTCAAGGTAAAAGG + Intergenic
917210727 1:172629590-172629612 TGATTAAAACTGTAGGAACAAGG + Intergenic
917285790 1:173420118-173420140 TCATCTCAAGTGCAGGGACAAGG - Intergenic
918287333 1:183070306-183070328 TGATTTTAAGTAAAGGGACAGGG + Intronic
918808740 1:189086762-189086784 TCATGTCATCTGCAGGGACATGG + Intergenic
919659513 1:200230069-200230091 GCATTTAGACTGAAAGGCCAGGG - Intergenic
919708491 1:200702491-200702513 TCATTTAGACAGGAGGGATAAGG + Intergenic
920786716 1:209049560-209049582 GCATTTAAACTGAAGCTTCATGG - Intergenic
921130183 1:212213183-212213205 TCATTTGAAGTGAAAGGACAGGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
921632520 1:217453114-217453136 TCATTTAGACTGAAGAAACAAGG - Intronic
921952326 1:220943338-220943360 TCATATAAACAGATGGGAAAAGG + Intergenic
922668183 1:227490356-227490378 TCATTCCAACTGAAGGAAAAGGG - Intergenic
923910291 1:238433787-238433809 TCATATAAACTCAAGGTAAAGGG + Intergenic
924081563 1:240404427-240404449 GTATTAAAACTGAAGTGACATGG + Intronic
924329103 1:242924683-242924705 TCATTCCAAGTGAGGGGACATGG + Intergenic
1064497652 10:15930658-15930680 TAATGTACAATGAAGGGACAAGG - Intergenic
1064599632 10:16980527-16980549 TCATGTACTTTGAAGGGACATGG + Intronic
1066016776 10:31253821-31253843 TCATTTTGAATGAATGGACATGG + Intergenic
1066164381 10:32770951-32770973 TCATATAAACTCAAGGAAAAGGG - Intronic
1066260521 10:33725219-33725241 TGACTAAGACTGAAGGGACAAGG - Intergenic
1067895190 10:50171512-50171534 TCATATAAACTCAAGGAAAAAGG + Intergenic
1067953795 10:50770464-50770486 TCATATAAACTCAAGGAAAAAGG - Intronic
1068844453 10:61656351-61656373 TCATTCAAAAAGAAGGCACATGG + Intergenic
1069457759 10:68567208-68567230 TCATTTTAGATGAAGGAACATGG + Intronic
1070744745 10:78926990-78927012 TCATCTCACCTGAAGGCACACGG + Intergenic
1071015684 10:80994944-80994966 TCATATAAACTTAAGGTAAAGGG - Intergenic
1071199367 10:83201218-83201240 TCATTTTGACTGATGTGACATGG + Intergenic
1073277900 10:102328630-102328652 TCCTATACACTGAAGGGATAGGG + Intronic
1074988952 10:118685100-118685122 TCATTTAAAATGAAGTGATCAGG + Exonic
1075991649 10:126843333-126843355 CCATTTAATCTCAAAGGACAGGG + Intergenic
1077792750 11:5459683-5459705 CCATTTAGACTGATGGGAGATGG - Intronic
1078284806 11:9941313-9941335 TTATTTTTACTGAAGAGACAGGG - Intronic
1081203848 11:40251368-40251390 TGATACAAACTGAAGGTACAAGG + Intronic
1082861047 11:57857017-57857039 TCAAGTAAACTGAATGAACAAGG + Intergenic
1084224418 11:67706704-67706726 TCTTTTAAAAGAAAGGGACATGG - Intergenic
1084262257 11:67986622-67986644 TCTTTTAAAAGAAAGGGACATGG - Intergenic
1084374292 11:68765302-68765324 TCTTTTAAACTGTGGGCACAAGG - Intronic
1086557238 11:88125531-88125553 TTATTTAATGTGAAGGGAAAAGG + Intronic
1086813451 11:91338713-91338735 TCATATAAACTCAAGGTACAGGG + Intergenic
1087192951 11:95275085-95275107 TCATTTAAACTGCAGAGATATGG - Intergenic
1087768281 11:102179870-102179892 TCATTTAAACTGAAGGGACAGGG - Intronic
1087940042 11:104085507-104085529 ACATTTAAACAGAAGCGACTTGG - Intronic
1088179659 11:107094573-107094595 TCATATAAACTTAAGGTAAAGGG + Intergenic
1088413316 11:109560983-109561005 TCATATAAACTCAAGGTAAAAGG - Intergenic
1088578771 11:111297574-111297596 TCATTTTAACTGAAAGGATGTGG - Intergenic
1088617635 11:111647052-111647074 TCATATTAACTGAAGATACAGGG - Intronic
1093338463 12:17939555-17939577 TCATTTAAATTATAGGGAAAAGG - Intergenic
1093963953 12:25305308-25305330 TCATATAAACTTAAGGTAAAGGG + Intergenic
1094769870 12:33643136-33643158 TATTTTAAACTGAATGAACACGG - Intergenic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1097581455 12:61462188-61462210 TCATATAAACTGAAGGTAAAGGG + Intergenic
1097932583 12:65205689-65205711 TCAGTTAAAGAGAAGGGAAAGGG - Intronic
1098343479 12:69475443-69475465 TCATTTAGACTGAAGCTAAATGG - Intronic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1100074882 12:90767543-90767565 TCATTTTAACTGAAAAGAGAAGG - Intergenic
1100708703 12:97230222-97230244 TCATTTAAGCTCAAAGGCCATGG - Intergenic
1100920834 12:99484876-99484898 TCATATAAACTGAGGGCAAAAGG - Intronic
1101440691 12:104702463-104702485 TGATGTCAACTGATGGGACATGG + Intronic
1104501504 12:129290650-129290672 TCATTTCTAATGAGGGGACAAGG + Intronic
1104767524 12:131340181-131340203 TCATTTAAAATGTAAAGACATGG - Intergenic
1104812253 12:131626408-131626430 TCATTTAAAATATAAGGACATGG + Intergenic
1105482722 13:20793733-20793755 TCATTTACATTGAAAGGGCAGGG - Intronic
1107070915 13:36267727-36267749 TCATATAAACTCAAGGTAAAAGG + Intronic
1107426618 13:40300211-40300233 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1107983148 13:45752580-45752602 TCATTTAAACTCAAGACACCTGG + Intergenic
1109036962 13:57275806-57275828 TAATTTAAAAAGAAGGGAAAGGG - Intergenic
1109772333 13:66993473-66993495 TGATTTACTTTGAAGGGACAGGG + Intronic
1110183536 13:72645700-72645722 TCATGGGAGCTGAAGGGACAGGG - Intergenic
1111587673 13:90303693-90303715 TCATTCTAACTGAAGTGAGATGG + Intergenic
1111873698 13:93866554-93866576 TCATTTCATTTGCAGGGACATGG + Intronic
1113005633 13:105698983-105699005 TAATTTAAACTTAAGGAACAAGG - Intergenic
1114003913 14:18290420-18290442 TCATTTAGAAGGAAGAGACAAGG - Intergenic
1114497188 14:23140886-23140908 TTATTTAAAAGGAAAGGACATGG + Intronic
1115473954 14:33796620-33796642 TCCTGTAATCTGAAGGCACAAGG - Intronic
1117590069 14:57258383-57258405 TCATATCCACTGCAGGGACATGG + Intronic
1118491236 14:66262945-66262967 ACATTAAAACAGAAGGTACATGG - Intergenic
1121808805 14:96859406-96859428 TCTGTTATACTGAAGGGATATGG + Intronic
1124050015 15:26188358-26188380 TCATGTCTTCTGAAGGGACAAGG + Intergenic
1124584041 15:30989193-30989215 GCATTTAAAATGCAGGGACGAGG - Intronic
1126180684 15:45782354-45782376 CCAGTTAAACTGAGGGGATAGGG - Intergenic
1126534784 15:49749625-49749647 ACATATAAACTGAAGGGACTTGG - Intergenic
1128115999 15:65106012-65106034 TCCTTTAAATTCAAGGAACAAGG + Intronic
1130443421 15:83977348-83977370 TCATTTAAACTTGAGGGACCTGG + Intronic
1131157061 15:90081779-90081801 TCTTGGAAACTGAAGGGAGAAGG + Exonic
1131913896 15:97240102-97240124 TTATCAAAACAGAAGGGACAGGG - Intergenic
1134191761 16:12127016-12127038 TCATTTAAAGTGTATGGCCAAGG + Intronic
1135127545 16:19823634-19823656 TCATTTAAAATGAATGGAGCTGG + Intronic
1135806890 16:25550842-25550864 TCATGTCAATTGCAGGGACATGG + Intergenic
1136987784 16:35127352-35127374 TCATTTAAATTGAAAGCACCAGG - Intergenic
1138306018 16:55975479-55975501 TCATGTCCATTGAAGGGACATGG + Intergenic
1139024196 16:62793953-62793975 TCATATAAACTCAAGGTAAAAGG - Intergenic
1139304646 16:65974548-65974570 TCTTTTAATTTGAAGGGGCATGG - Intergenic
1139306730 16:65992729-65992751 GCATTTTGACTGAATGGACAAGG - Intergenic
1140444517 16:75014372-75014394 TCATGTAAACTGTATAGACATGG + Intronic
1140655415 16:77134630-77134652 TCATGTAATTTGCAGGGACATGG - Intergenic
1141367321 16:83455762-83455784 TCACTTAAAGTGCAGGGCCAGGG + Intronic
1144222753 17:13114808-13114830 TCATGTTTACTGAAGGGAAAGGG + Intergenic
1144276555 17:13674421-13674443 TCATATAAACTCAAGGTAAAAGG + Intergenic
1146808633 17:35885647-35885669 CCATGCACACTGAAGGGACAGGG - Intergenic
1149784505 17:59423753-59423775 TCATTTCAGGTGAAGGGCCACGG + Intergenic
1149903443 17:60503318-60503340 ACATTTAAATTGACGGGAAAGGG + Intronic
1151754457 17:76065122-76065144 TCCTTTACTCTGAAGAGACAAGG - Intronic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1152022928 17:77790544-77790566 TCATTTAAACTGCAGGCTCCAGG + Intergenic
1155286979 18:24299093-24299115 TCATATAAACTCAAGGTAAAGGG - Intronic
1155734606 18:29204627-29204649 ACATATAATCTGAAGGGAAAGGG + Intergenic
1156208866 18:34916738-34916760 TCATGTCAATTGCAGGGACACGG + Intergenic
1156773175 18:40755040-40755062 TCCTATAAACTGAAGGTAAAAGG - Intergenic
1157326685 18:46674250-46674272 TCATTTAAACTAGAGGAAAAAGG + Intronic
1157432100 18:47637005-47637027 TCATTTAATCTGAATAGACGAGG - Intergenic
1157457075 18:47841940-47841962 TCTTTTAAACAGAAGGCAGACGG - Exonic
1158290457 18:55935047-55935069 GCAATTAAACTAAAGTGACAAGG - Intergenic
1158825741 18:61216716-61216738 ACATTTAAACTGAAACAACATGG + Intergenic
1158927714 18:62286003-62286025 TCATTTAAACTGTAGTCTCAAGG - Intronic
1158992407 18:62882869-62882891 TTATTTAAATTGAATGGATAAGG + Intronic
1159037897 18:63295207-63295229 TCATAGAAAGTGTAGGGACAAGG + Intronic
1159566237 18:70053906-70053928 TCATTTAAACTGAAAACTCAAGG + Intronic
1159760220 18:72416638-72416660 TCATGTCCACTGCAGGGACATGG + Intergenic
1159821523 18:73152127-73152149 TTATTTAAAGAGAAGTGACAAGG - Intronic
1160591317 18:79946179-79946201 CCTTTTAAAATGAAGTGACAGGG + Intronic
1161680099 19:5675875-5675897 TAATTAAATCTGAAAGGACAAGG - Intronic
1163855658 19:19700110-19700132 TCACTTAAACTTAAGGCAAAGGG - Intergenic
1163871662 19:19826314-19826336 TCACTTAAACTTAAGGGAAAGGG + Intergenic
1163886366 19:19968788-19968810 TCACTTAAACTTAAGGTAAAGGG - Intergenic
1164422608 19:28108644-28108666 TCATATAAACTCAAGGTAAAGGG + Intergenic
1166428904 19:42706080-42706102 TCATGTAAACTTAAGGTAAAAGG - Intronic
1167820883 19:51926860-51926882 TCATTTACATTTGAGGGACACGG - Intronic
926071162 2:9892943-9892965 TAATTTTGAGTGAAGGGACAGGG + Intronic
926260240 2:11253418-11253440 ATATTTAAACTGAATGGATAAGG - Intronic
926653675 2:15374460-15374482 TCATTTAAAATAATGGGTCAAGG + Intronic
927040427 2:19224885-19224907 TCATTTTAACCGAAGGTAGACGG + Intergenic
928384744 2:30857446-30857468 CCATTTCAACTGGAGGGAGATGG - Intergenic
928479940 2:31673012-31673034 TCATATAAACTCAAGGTAAATGG - Intergenic
929203577 2:39264279-39264301 TTATTTAAACTGAAAGCTCAGGG - Intronic
929355095 2:41014251-41014273 TCATGTAAAGTGATGGGACCTGG + Intergenic
929787790 2:45004599-45004621 GCAGTGAAACTGAAGGGTCAGGG - Intergenic
929834700 2:45384735-45384757 TCATTTAAGCTGAGGGGAGCGGG - Intergenic
932144516 2:69306420-69306442 TCATTTAAACTGGTGGGCCTGGG + Intergenic
933305914 2:80598142-80598164 TCATATTAATTGCAGGGACATGG + Intronic
933576706 2:84077627-84077649 TCACATAAAATGAAGGGAGATGG - Intergenic
935353106 2:102171979-102172001 GCTTTTAAACTGAACCGACAAGG - Intronic
936815326 2:116453956-116453978 TCATATAAACTTAAGGTAAAAGG - Intergenic
936869997 2:117125264-117125286 TCATGAAAACTTAAAGGACAGGG - Intergenic
936872517 2:117149340-117149362 TCATTTTAACTGGAGTGAGATGG + Intergenic
937982970 2:127625682-127625704 TGCTTAAACCTGAAGGGACAGGG - Intronic
939617533 2:144377922-144377944 ACATTTAAAATTAAGGGGCAGGG - Intergenic
939776385 2:146392667-146392689 TCATTTAAAATATAAGGACATGG + Intergenic
941859255 2:170262159-170262181 TCATTTAAGCTGAACCTACAAGG + Intronic
942061653 2:172233426-172233448 TGGTTTAAAGTGAGGGGACAAGG + Intergenic
942146133 2:173028586-173028608 TCACCTAAACAGAAGGGAGAGGG - Intronic
942973611 2:181987542-181987564 TAATTTACAATGAAGGTACAGGG - Intronic
943607665 2:189995480-189995502 TCATGTAAACTTAAGGTAAAAGG - Intronic
943909490 2:193544518-193544540 TCATATAAACTTAAGGTAAAGGG + Intergenic
944095539 2:195963298-195963320 CCATTTTAACTGAAGTGACATGG + Intronic
944149142 2:196538748-196538770 TCATATAAAATGAAGGTACCTGG - Intronic
944349283 2:198708123-198708145 TCCTTGAAAGTAAAGGGACAGGG - Intergenic
944603185 2:201324133-201324155 TCAAATAAACTCAAGGGAAAAGG + Intronic
945006075 2:205408201-205408223 TGATTTAAACTAAAGGGAACAGG - Intronic
945634903 2:212336328-212336350 TCCTTAAATCTGAAGGGAGATGG - Intronic
947774934 2:232700668-232700690 TAATTTAAACTGAAGGAAAATGG - Intronic
947778360 2:232733525-232733547 TCATTTAAACAGAGGCAACAGGG + Intronic
1170444722 20:16414438-16414460 ACATTGAAAAAGAAGGGACAAGG - Intronic
1170515908 20:17130208-17130230 TAATTTAGACTGGAGGGTCAGGG - Intergenic
1170729615 20:18961959-18961981 TCACTTAGACCCAAGGGACAAGG + Intergenic
1172288486 20:33758115-33758137 TCCATTAAACTGAAGGCAGAAGG - Intronic
1174692360 20:52519170-52519192 TGATTTAAAGGGAAGGGAAATGG - Intergenic
1174974071 20:55311052-55311074 TCATGTCCATTGAAGGGACATGG + Intergenic
1176873138 21:14099970-14099992 TCATGAAAACTGATGGGGCAGGG + Intergenic
1178891106 21:36521840-36521862 TCCTTGAGAGTGAAGGGACAGGG - Intronic
1179408264 21:41142816-41142838 CCATTTAAACTGGAGGGCAAGGG + Intergenic
1179576998 21:42313999-42314021 TCATTTAAAACAAAGGGGCAAGG - Intronic
1180428427 22:15221223-15221245 TCATTTAGAAGGAAGAGACAAGG - Intergenic
1182199027 22:28550833-28550855 TCATATAAACTTAAGGCAAAGGG + Intronic
949877802 3:8637932-8637954 TTATTAAACTTGAAGGGACAGGG - Intronic
950507828 3:13406693-13406715 TCATTTAGACTGGATGGGCAGGG - Intronic
950595175 3:13973811-13973833 TCATATAAACTCAAGGTAAAGGG - Intronic
950603989 3:14061849-14061871 ACAATTAAAATGATGGGACATGG - Intronic
951728081 3:25782435-25782457 TCAAATGATCTGAAGGGACATGG - Intronic
951767904 3:26220638-26220660 TCATTTTAACTGGAGTGAGATGG + Intergenic
951859086 3:27230644-27230666 TCAAATAAACTTAAAGGACAGGG + Intronic
951941118 3:28079868-28079890 GCATTTAAAGTGAGAGGACAGGG - Intergenic
952279590 3:31910287-31910309 GCCTTTAAACAGGAGGGACATGG + Intronic
952601700 3:35090856-35090878 TCATATAAACTTAAGGTAAAGGG + Intergenic
952695630 3:36262324-36262346 TCATGTTCATTGAAGGGACATGG - Intergenic
952700908 3:36326774-36326796 TCATGTAATTTGTAGGGACATGG + Intergenic
952993907 3:38858293-38858315 TCATATAAACTTAAGGTAAAGGG + Intronic
956116897 3:65927993-65928015 TTATGTATACTGAAGGGACTTGG - Intronic
956450854 3:69373209-69373231 TCATTTAAACTAAAGTAAAAAGG - Intronic
957077667 3:75614429-75614451 TCTTTTAAAAGAAAGGGACATGG - Intergenic
958524390 3:95236446-95236468 TCAATTAAACTGGAGCGAAAAGG - Intergenic
958768534 3:98399156-98399178 TCATATAAACTCAAGGTAAAGGG + Intergenic
958790008 3:98641571-98641593 TCATATAAACTTAAGGTAAAGGG - Intergenic
961427397 3:126858795-126858817 TCTATTAGACTGAATGGACATGG - Intronic
961763595 3:129190362-129190384 TCATTTAAAATGAATGGATTAGG - Intergenic
961883760 3:130081998-130082020 AATTTTAACCTGAAGGGACATGG + Exonic
961977900 3:131045972-131045994 TCATGTAAACTTAAGGTAAAGGG - Intronic
962852184 3:139316433-139316455 TCATTTATACTGAACGGTCCAGG + Intronic
962861980 3:139412582-139412604 TCATATAAACTTAAGGTAAAGGG - Intergenic
963511008 3:146249470-146249492 TAAATGAAACTGAAGAGACATGG - Intronic
963832662 3:150024838-150024860 TCATATAAACTTAAGGTAAAGGG + Intronic
964075853 3:152690563-152690585 TCACATAAACTTAAGGGAAAGGG + Intergenic
964090467 3:152870202-152870224 TGATTTCTACAGAAGGGACATGG + Intergenic
965184753 3:165448397-165448419 TCATATAAACTTAAGGTAAATGG + Intergenic
966562102 3:181333544-181333566 ACATTTAAATTGAAGTTACAAGG - Intergenic
966622015 3:181975516-181975538 TCATTTTAACTGGAGTGAGATGG + Intergenic
966823713 3:183945584-183945606 TCAGTTAAGCTGAACTGACAAGG + Intronic
967947954 3:194818966-194818988 TCCTCTTAACTCAAGGGACATGG - Intergenic
968130271 3:196189056-196189078 TCATAGAAAATGAAGGCACAAGG + Intergenic
969020746 4:4138447-4138469 TCTTTTAAAAGAAAGGGACACGG - Intergenic
969097105 4:4741766-4741788 TCACTTTAATTGAAGTGACAGGG - Intergenic
969733110 4:8968968-8968990 TCTTTTAAAAGAAAGGGACATGG + Intergenic
969792688 4:9503047-9503069 TCTTTTAAAAGAAAGGGACATGG + Intergenic
971007855 4:22395577-22395599 TCATTCAAACTGAAGTTAGATGG + Intronic
971343861 4:25794891-25794913 TCATGTCCTCTGAAGGGACATGG + Intronic
971721691 4:30253567-30253589 TCATATAAACTCAAGGTAAAGGG - Intergenic
971908135 4:32755946-32755968 TCATATAAACTCAAGGTAAAAGG + Intergenic
972900591 4:43677619-43677641 TCATTAAAACAGAATGTACATGG + Intergenic
973111103 4:46398961-46398983 TGATTTAAAAAGAAGGGATAAGG + Intronic
973180179 4:47257257-47257279 TCACTAAACCTGAAGGGAAAAGG - Intronic
974749278 4:66115622-66115644 TCATGTACTCTGCAGGGACATGG + Intergenic
974824436 4:67109012-67109034 TCATTATAACTGAAGGTAAATGG + Intergenic
974995341 4:69150105-69150127 TCATTTAAGCTTGAAGGACAGGG - Intronic
975972473 4:80058138-80058160 TGATTTGAACTGAATGGAGAAGG - Intronic
976689232 4:87850968-87850990 TCATTTAAAGTGAACGTACAAGG + Intergenic
977510701 4:97958517-97958539 TCATATAAACTTAAGGTAAAGGG + Intronic
977840819 4:101701755-101701777 TAATTTAGACTGAAGGCTCAAGG - Intronic
978051396 4:104204693-104204715 TCATTTCATTTGCAGGGACACGG + Intergenic
978685028 4:111430604-111430626 TCATTTCCTCTGCAGGGACATGG - Intergenic
979195235 4:117913400-117913422 TCATATAAACTCAAGGTAAAGGG - Intergenic
979342812 4:119547609-119547631 ACATAAAAACTGAAGGTACATGG - Intronic
980177174 4:129360483-129360505 TTCTTTATCCTGAAGGGACAGGG - Intergenic
980536392 4:134128950-134128972 TCATATAAACTTAAGGTAAAGGG + Intergenic
980748106 4:137048068-137048090 AAATTAAAAGTGAAGGGACAGGG - Intergenic
981091136 4:140733708-140733730 TCATGAAAACTCAAGGTACATGG + Intronic
982035335 4:151340513-151340535 TGATTTAAAGTGAAGGAGCAGGG - Intergenic
982167417 4:152627271-152627293 ACATATAAACCGAAGGGAGATGG - Exonic
983277644 4:165637529-165637551 TCATATAAACTTAAGGTAAAGGG + Intergenic
987157301 5:15102572-15102594 TCATTAAAACCAAAAGGACAAGG + Intergenic
987843448 5:23251808-23251830 TCGTTTACACTGAAAGGGCAGGG - Intergenic
988277856 5:29105995-29106017 GCATTTAAATTGAAAGCACAAGG - Intergenic
988571458 5:32371328-32371350 TCATCTAAACTGGAGGGCGATGG - Intronic
988788526 5:34585982-34586004 TCATTTTGACTCAAGGAACATGG - Intergenic
989027541 5:37084885-37084907 TCATATAAACTTAAGGTAAAGGG + Intergenic
990310916 5:54537155-54537177 TAATTTAAACTGTAGAGACAAGG - Intronic
990471618 5:56121103-56121125 TCATCTGACCTGAAGGGATAAGG + Intronic
992243791 5:74796728-74796750 TCATTTATACTGAAGGACCATGG + Intronic
992335848 5:75768694-75768716 TCATGTAAACTTAAGGTAAAGGG - Intergenic
995010273 5:107249505-107249527 TTATTTCAACTGAAGAAACAGGG - Intergenic
995045023 5:107635917-107635939 ACAGTTAAACCTAAGGGACATGG + Intronic
995187229 5:109284361-109284383 TCATATAAACTCAAGGTAAAGGG + Intergenic
995718395 5:115103580-115103602 TCATCTACACTGAAGGAATAAGG + Intergenic
997871520 5:137509657-137509679 TCTTGTGAAATGAAGGGACAGGG + Intronic
998709871 5:144811775-144811797 TCATGTAAACTGAACTAACAAGG - Intergenic
998732189 5:145091372-145091394 TCAGTAAAATTGAAGGGTCATGG + Intergenic
999757958 5:154679347-154679369 TCATTTAATCTTGAGAGACAGGG + Intergenic
1001693575 5:173652177-173652199 TCATATAAACTTAAGGCAAATGG - Intergenic
1003511636 6:6786032-6786054 TCAATAAAACTGAAGGGACGGGG + Intergenic
1005435356 6:25804659-25804681 TCATATAAACTCAAGGTAAAAGG + Intronic
1005569325 6:27129578-27129600 TGATCTAAACTGAATGTACATGG - Intronic
1005762407 6:28979554-28979576 TCATTAAAATTGGAGGGATAGGG + Intergenic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1006783412 6:36648219-36648241 TCATTCAAACTCAAGAGACCTGG + Intergenic
1007206841 6:40159557-40159579 TCCTGAAAACTGGAGGGACAGGG - Intergenic
1008736108 6:54545995-54546017 TCACTTAAACTTAAGGTAAAGGG - Intergenic
1008882719 6:56397093-56397115 TCATATAAACTCAAGGTAAAGGG + Intergenic
1010077042 6:71810680-71810702 TCATTTAAACTGGTGTGAGATGG - Intergenic
1011010666 6:82700347-82700369 TCATTTAAACTTATAGGTCATGG - Intergenic
1014161776 6:118178121-118178143 GAATTTGAACAGAAGGGACATGG - Intronic
1014362701 6:120499863-120499885 TAATTTAAAATGAAAGGGCAGGG - Intergenic
1015807984 6:137131731-137131753 TCATTTCAGCTGAAGGGTGAAGG + Intergenic
1015886247 6:137921705-137921727 TCCTTTAGACTGAAGGGTCAGGG + Intergenic
1016482754 6:144499504-144499526 TAATATAAAATGGAGGGACATGG - Intronic
1017704123 6:157105172-157105194 TCAAATAAACTCAAGGGAGATGG + Intronic
1017963025 6:159238745-159238767 TCATTTATAATGAATGGTCATGG + Intronic
1018745449 6:166758136-166758158 TCATTTAAACTGAAAGGAGGAGG + Intronic
1020308167 7:6850480-6850502 TCTTTTAAAAGAAAGGGACATGG - Intergenic
1020635100 7:10686834-10686856 TCATATAAACTTAAGGTAAATGG + Intergenic
1022673555 7:32477980-32478002 TCATTGAAACAGAAGAGAAAAGG + Intergenic
1022946683 7:35292308-35292330 TCATTTATAGGAAAGGGACAAGG + Intergenic
1023164868 7:37333673-37333695 TCCTTTAAAATGAAGTGACTGGG - Intronic
1023483613 7:40660923-40660945 TCATGTACAATGAAGGGACAGGG - Intronic
1023501155 7:40850726-40850748 TTTTTTAAAGTGAAGGGAAAAGG - Intronic
1024447452 7:49497883-49497905 TCTTTTCAACTGGATGGACAAGG + Intergenic
1026014785 7:66664595-66664617 TAATTTAAATTTAAGAGACACGG - Intronic
1026239268 7:68557860-68557882 TCCTTTACAAGGAAGGGACAAGG + Intergenic
1028132156 7:87188078-87188100 TTATTAAGACTGAAGGGAGATGG - Exonic
1028197376 7:87922533-87922555 TCACATAAACTTAAGGGAAAGGG + Intergenic
1028288184 7:89030807-89030829 TCATTAAAACTGGAGGGTCAAGG - Intronic
1028888067 7:95956687-95956709 TCATGTCATCTGCAGGGACATGG - Intronic
1029035865 7:97521006-97521028 TCGTTAAAACTGAAGGAAGATGG - Intergenic
1030972514 7:116077550-116077572 TCATATAAACTTAAGGTAAAGGG + Intronic
1031611762 7:123836445-123836467 TCATATAAACTTAAGGTAGAGGG - Intronic
1031796725 7:126184604-126184626 TCATGTAAACTGAAGGTAAAGGG - Intergenic
1031857411 7:126939166-126939188 TCATTAAAACTCAAGGCACTGGG - Intronic
1031878194 7:127165516-127165538 ACATTTAAAATGAAAGGAAAAGG - Intronic
1032469849 7:132170400-132170422 TGATGTAAACTGAAAGGAGAGGG + Intronic
1032788574 7:135222447-135222469 TCCTTTAAACTGAAAAGAAAGGG + Intergenic
1034682993 7:152945177-152945199 TCATATAAACTTAAGGTAAAGGG - Intergenic
1034836093 7:154352511-154352533 TCCTTAAAAATGCAGGGACATGG + Intronic
1036420640 8:8592302-8592324 ACATTAAAAATGAAGGGAAAGGG - Intergenic
1036702780 8:11024131-11024153 TCATTTAAACTTGAGGGCGAGGG - Intronic
1037181503 8:16012342-16012364 ACATTTGCACTGTAGGGACATGG + Intergenic
1037223019 8:16548485-16548507 GGATTTAAACTGGAGGAACAAGG + Intronic
1037958814 8:23080791-23080813 TCATTGAAACAAAAGTGACAGGG - Intergenic
1039261867 8:35780555-35780577 TCCTTTAAAGTGAAGGAAGAAGG + Intronic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1040529164 8:48251988-48252010 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1040735607 8:50504150-50504172 TCATGTCCACTGCAGGGACATGG - Intronic
1040753500 8:50740825-50740847 TCATTTACATTGCAGGCACATGG + Intronic
1041424402 8:57703865-57703887 TTATCTAAACTCAAGTGACAGGG + Intergenic
1041750904 8:61260051-61260073 ACATTTAAACTGAAAGCAAAGGG - Intronic
1042431590 8:68712465-68712487 TCATATAAACTTAAGGTAAAGGG + Intronic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1042991443 8:74644972-74644994 GCATCTAAAATGAAGGGACAGGG - Intronic
1043847428 8:85178101-85178123 TTATTTAAACTACAGGAACATGG - Intronic
1044282168 8:90368714-90368736 GCATCTCATCTGAAGGGACAAGG + Intergenic
1044327555 8:90876823-90876845 TCATTTAAACTGATGAGAATTGG + Intronic
1044489448 8:92794937-92794959 ACATTTTAACTGATGGGAAATGG - Intergenic
1045413334 8:101942065-101942087 TTATTTAAAGTGAAGTGAAAAGG + Intronic
1046733741 8:117753618-117753640 TCATTTAAAATAAAGTGACAAGG + Intergenic
1048120241 8:131572487-131572509 TCATGTAAACTTAAGGTAAAGGG - Intergenic
1048129296 8:131676191-131676213 TGATTTAAAGTGAAGAGATATGG + Intergenic
1048262158 8:132954385-132954407 TCATTTAAATAGGAAGGACAAGG + Intronic
1048507719 8:135035723-135035745 TGATTTAATCTTAAGGGAGAGGG - Intergenic
1049069474 8:140345614-140345636 GCATTTAGTCGGAAGGGACAGGG - Intronic
1050263087 9:3861621-3861643 TCATGTAATTTGCAGGGACATGG + Intronic
1051547974 9:18297749-18297771 TCCTCTTAACTGAAGGGAAAGGG + Intergenic
1051957846 9:22718057-22718079 TCATCAAAACTGAATGGCCAAGG - Intergenic
1052983059 9:34463063-34463085 TCATTTAAATAGGATGGACAGGG + Intronic
1056457745 9:86778954-86778976 TAATTGAAACTGAATGTACAAGG - Intergenic
1057340331 9:94195454-94195476 TCATATAAACTCAAGGTAAAGGG - Intergenic
1057615145 9:96582905-96582927 TTACTTTAACTGCAGGGACAAGG + Intronic
1057643079 9:96846468-96846490 TCATATAAACTCAAGGTAAAGGG + Intronic
1061462555 9:130751889-130751911 ACATTTAAACTGTAGGTGCAGGG + Intronic
1062202152 9:135309268-135309290 TCCTAGAAACAGAAGGGACAAGG - Intergenic
1186120971 X:6360476-6360498 TCATTTAAAAAGAAGAAACAAGG - Intergenic
1186308617 X:8292086-8292108 TCATATAAACTTAAGGTAAAAGG + Intergenic
1188479103 X:30619421-30619443 TCATTTAAATTTAAAAGACAGGG + Intergenic
1188486942 X:30692438-30692460 TTATTTAATTTGAAGGAACAAGG - Intronic
1188956412 X:36439475-36439497 TCATATAAACTTAAGGTAAAAGG + Intergenic
1189657560 X:43261575-43261597 TCATGTTATCTGCAGGGACATGG - Intergenic
1189659633 X:43283603-43283625 TCATTCAAACTGGAGTGAAATGG + Intergenic
1189895159 X:45647880-45647902 TCAACTAAATTGAAGGGACGTGG - Intergenic
1192253075 X:69429712-69429734 TCATCTGAACTGAAGGGAATAGG + Intergenic
1192885431 X:75332673-75332695 TCATATAGACTCAAGGTACAAGG - Intergenic
1193255562 X:79344465-79344487 TCATATAAACTTAAGGTAAAGGG + Intergenic
1194144524 X:90246221-90246243 TCATATAAACTCAAGGTAAAGGG + Intergenic
1194237392 X:91401055-91401077 TCACTTAAACTTAAGGTAAACGG + Intergenic
1194557073 X:95372810-95372832 TCATATAAACTCAAGGTAAATGG + Intergenic
1194587631 X:95755635-95755657 TCATGTAATTTGCAGGGACATGG - Intergenic
1194636700 X:96353425-96353447 TCATTTCAACCCAAAGGACAGGG - Intergenic
1195231788 X:102857599-102857621 TCATATAAACTTAAGGTAAAGGG - Intergenic
1195490427 X:105462413-105462435 TCATTTTAACTAAAATGACATGG - Intronic
1195972558 X:110489680-110489702 TCATATAAACTTAAGGTAAAGGG - Intergenic
1196131453 X:112161513-112161535 TCATTCATACTGAAGGGTGAGGG - Intergenic
1197131770 X:123013988-123014010 CCACTTTTACTGAAGGGACAGGG + Intergenic
1197334341 X:125193817-125193839 TCATTTAGACTGGAGTGCCATGG + Intergenic
1198030121 X:132746681-132746703 TCAGTTAGACTGAAAGGCCATGG - Intronic
1198616643 X:138465130-138465152 TCATATAAACTTAAGGTAAAGGG + Intergenic
1199077405 X:143539903-143539925 TCATATAAACTCAAGGTAAAGGG + Intergenic
1199121809 X:144063057-144063079 TCATATAAACTTAAGGTAAAGGG + Intergenic
1199241944 X:145557111-145557133 TCCTATAAACTCAAGGGAAAGGG + Intergenic
1199323126 X:146464150-146464172 TCATATAAACTCAAGGTAAAGGG - Intergenic
1200836015 Y:7732231-7732253 TCATCTAGACTGAAGAGACAAGG + Intergenic
1200902687 Y:8448610-8448632 TCACTGTAACTGAAGGGCCAAGG + Intergenic
1201226480 Y:11823794-11823816 TCATTCCAAGTGAGGGGACATGG + Intergenic
1201561036 Y:15316990-15317012 TCATTCTAACTGATGTGACATGG + Intergenic
1201623605 Y:15987950-15987972 TCAGTTTAACTGATGTGACAAGG - Intergenic
1201624023 Y:15993564-15993586 TCATATATTTTGAAGGGACACGG + Intergenic