ID: 1087768331

View in Genome Browser
Species Human (GRCh38)
Location 11:102180284-102180306
Sequence CTAATTAGTAGATCCTATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087768328_1087768331 -2 Left 1087768328 11:102180263-102180285 CCTTGGCCTCCTAATCTATTTCT 0: 1
1: 0
2: 3
3: 37
4: 385
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768327_1087768331 1 Left 1087768327 11:102180260-102180282 CCTCCTTGGCCTCCTAATCTATT 0: 1
1: 2
2: 40
3: 957
4: 12416
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768326_1087768331 2 Left 1087768326 11:102180259-102180281 CCCTCCTTGGCCTCCTAATCTAT 0: 1
1: 1
2: 6
3: 209
4: 2958
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768322_1087768331 19 Left 1087768322 11:102180242-102180264 CCTGACCTCATGATCCTCCCTCC 0: 18
1: 1004
2: 17754
3: 60951
4: 68046
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768329_1087768331 -8 Left 1087768329 11:102180269-102180291 CCTCCTAATCTATTTCTAATTAG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768324_1087768331 14 Left 1087768324 11:102180247-102180269 CCTCATGATCCTCCCTCCTTGGC 0: 6
1: 279
2: 4765
3: 25221
4: 60224
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73
1087768325_1087768331 5 Left 1087768325 11:102180256-102180278 CCTCCCTCCTTGGCCTCCTAATC 0: 1
1: 8
2: 194
3: 5251
4: 58916
Right 1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG 0: 1
1: 0
2: 0
3: 4
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087768331 Original CRISPR CTAATTAGTAGATCCTATAC TGG Intronic
900006111 1:53273-53295 TTAATGTGTAGATCCTAGACAGG - Intergenic
918411577 1:184263898-184263920 CCAATTAGTAAATCCTACAATGG + Intergenic
918605384 1:186418543-186418565 CTAATTATTAGATTTTATAATGG + Intronic
1071280664 10:84099660-84099682 CTAATTCTTAGATCTTCTACAGG - Intergenic
1087768331 11:102180284-102180306 CTAATTAGTAGATCCTATACTGG + Intronic
1089423675 11:118351743-118351765 TTATTTGGAAGATCCTATACAGG + Intronic
1092920386 12:13226142-13226164 CCAAATAGTAGATTCTACACAGG - Intergenic
1114957163 14:27837268-27837290 CTAATTAGTTGAGTCAATACAGG + Intergenic
1115063474 14:29224009-29224031 CTAAGTAATAGAACCTATTCTGG + Intergenic
1117432418 14:55681201-55681223 CTAATTGCTAGATCCAATATAGG + Intronic
1119961447 14:78861907-78861929 ATAATTAAAATATCCTATACTGG - Intronic
1120197717 14:81503697-81503719 GTTATTATTAGATCGTATACTGG - Intronic
1120510737 14:85410959-85410981 CTATTTAGTGGATCGTATTCTGG + Intergenic
1131883897 15:96888497-96888519 CTAATAAGAAGATCATATAGTGG - Intergenic
1132447408 15:101937650-101937672 TTAATGTGTAGATCCTAGACAGG + Intergenic
1137971966 16:52994590-52994612 CTAATTAGCAAATCTTTTACTGG + Intergenic
1139938720 16:70589949-70589971 AAAAATAGTAGATCCTTTACAGG + Intronic
1143442277 17:6984298-6984320 CTGATTAATAGTTTCTATACTGG - Intronic
1144112698 17:12051867-12051889 CTAAGTACTAGAGCCTCTACTGG - Intronic
1146557183 17:33835942-33835964 ATAATTAGTATTTCATATACTGG - Intronic
1150981387 17:70145994-70146016 TTATTTAGTAGATCTGATACAGG + Intergenic
1153747279 18:8192725-8192747 CTTATTATTAGATCTTATATTGG - Intronic
1155198574 18:23497906-23497928 ATATTTTGTAGATCCTATACTGG - Intergenic
1157072610 18:44426004-44426026 TTGATTAGTTGATCCAATACTGG + Intergenic
1157297029 18:46452935-46452957 CTCATTAGTAGCTACCATACGGG + Intronic
1158251737 18:55496790-55496812 CTAAATAGTAGAATATATACAGG + Intronic
1158789303 18:60757236-60757258 CTAATTATTAGATTAAATACAGG + Intergenic
1160047462 18:75400287-75400309 CTAATCAGTAGATTCCATCCAGG + Intergenic
1160637866 19:94883-94905 TTAATGTGTAGATCCTAGACAGG - Intergenic
1202646808 1_KI270706v1_random:149469-149491 CTAATGAGTAGATCTTTTTCTGG - Intergenic
927690374 2:25203948-25203970 CTAAATAGGACATCCTAAACAGG + Intergenic
928619067 2:33070701-33070723 CTAATTTGTAGATCCTGTGCAGG + Intronic
934480119 2:94630595-94630617 CTAATTAGTCGAGTCAATACAGG - Intergenic
936067450 2:109343219-109343241 CTAATTAGTTAATCTTATAAAGG + Intronic
941912537 2:170778359-170778381 CAAATTAGTAGGTACTATTCTGG + Intergenic
1169442278 20:5642574-5642596 GTAATTAGTAGTTGCTTTACAGG + Intergenic
1173458265 20:43221261-43221283 CAATTCAGTTGATCCTATACTGG - Intergenic
1176605057 21:8823306-8823328 CTAATGAGTAGATCTTTTTCTGG + Intergenic
1180347349 22:11714911-11714933 CTAATGAGTAGATCTTTTTCTGG + Intergenic
1180355109 22:11833015-11833037 CTAATGAGTAGATCTTTTTCTGG + Intergenic
1180383142 22:12159316-12159338 CTAATGAGTAGATCTTTTTCTGG - Intergenic
955575170 3:60353385-60353407 CTTTTTAGTAGACCCTCTACTGG - Intronic
956561524 3:70581802-70581824 CTAATTTGTATGTTCTATACTGG + Intergenic
957183052 3:76906131-76906153 ATTATTAGTAGATCTTATAAAGG - Intronic
958834764 3:99131961-99131983 GGAATTAGTAGAACCTATATTGG + Intergenic
965123714 3:164596208-164596230 ATAATTAATATATCCTTTACTGG + Intergenic
965232872 3:166075808-166075830 CTAATTGGAAGATGCTATATTGG - Intergenic
970468770 4:16354745-16354767 CAAATTAGTAGATCAGATACAGG - Intergenic
973373058 4:49267633-49267655 CTAATGAGTAGATCTTTTTCTGG - Intergenic
973387943 4:49527448-49527470 CTAATGAGTAGATCTTTTTCTGG + Intergenic
975425687 4:74224357-74224379 GCAATTAGTAGATACCATACAGG - Intronic
982628286 4:157796785-157796807 CTTTTTAGTAGATCACATACTGG - Intergenic
987061438 5:14247425-14247447 CTAATTCGTATATCCTATTATGG + Intronic
987586336 5:19861677-19861699 CTTATTAGTAAATCCAATATGGG + Intronic
988684334 5:33513204-33513226 CTAATTTGTTGATCCCATTCTGG + Intergenic
992018202 5:72596548-72596570 AGATTTAGTAGATCCAATACAGG + Intergenic
998575793 5:143314640-143314662 CTAATTTTAAGATCTTATACAGG + Intronic
1010293785 6:74171584-74171606 GTAATTTGTAGTTGCTATACTGG - Intergenic
1014918598 6:127184396-127184418 AAAATTAGTAGATGATATACTGG + Intronic
1016173492 6:141049397-141049419 CTATTTAGTTGATACTATCCTGG - Intergenic
1019100049 6:169622965-169622987 CTAATTTGTAGGTCCTACAAAGG - Intronic
1030697837 7:112604876-112604898 CTAATTAGTTGATCCTAAGCTGG + Intergenic
1032247827 7:130228268-130228290 CCAATTAGTGGATTCTAAACAGG + Intergenic
1038322162 8:26537280-26537302 CTATTTAGTGGAGCCTATTCTGG + Intronic
1051795732 9:20867638-20867660 TAAATTAGTAGATCCTATTAAGG + Intronic
1052599551 9:30607480-30607502 CTGACTAGTAGATACTTTACTGG - Intergenic
1053677719 9:40453205-40453227 CTAATTAGTCGAGTCAATACAGG + Intergenic
1053927636 9:43081039-43081061 CTAATTAGTCGAGTCAATACAGG + Intergenic
1054286006 9:63171750-63171772 CTAATTAGTCGAGTCAATACAGG - Intergenic
1054290793 9:63288731-63288753 CTAATTAGTCGAGTCAATACAGG + Intergenic
1054388814 9:64593278-64593300 CTAATTAGTCGAGTCAATACAGG + Intergenic
1054506903 9:65923093-65923115 CTAATTAGTCGAGTCAATACAGG - Intergenic
1203696768 Un_GL000214v1:105638-105660 CTAATGAGTAGATCTTTTTCTGG - Intergenic
1203552446 Un_KI270743v1:175391-175413 CTAATGAGTAGATCTTTTTCTGG + Intergenic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1188313673 X:28647988-28648010 CAAATTAGAAGATCCTAAATAGG + Intronic
1199527008 X:148803966-148803988 CTAATTACTGAATCCTATTCAGG - Intronic
1201153717 Y:11110968-11110990 CTAATGAGTAGATCTTTTTCTGG + Intergenic