ID: 1087771971

View in Genome Browser
Species Human (GRCh38)
Location 11:102220653-102220675
Sequence GGGTCTGGAGTCTCTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087771964_1087771971 16 Left 1087771964 11:102220614-102220636 CCAAAAGACAGCCAATAGACTAG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG 0: 1
1: 1
2: 3
3: 28
4: 257
1087771966_1087771971 5 Left 1087771966 11:102220625-102220647 CCAATAGACTAGACTAGTAAGGA 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG 0: 1
1: 1
2: 3
3: 28
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087771971 Original CRISPR GGGTCTGGAGTCTCTGAGGT TGG Intronic
900587560 1:3440473-3440495 GGGGCTGGAGTGGCTGAGGAGGG - Intergenic
900603781 1:3514971-3514993 GGGGCTGGAGTCACAGAGCTGGG - Intronic
900974359 1:6007923-6007945 GGGGCTGGAGACGCTGAGGCAGG + Intronic
901220754 1:7582427-7582449 GGCTCTGGATTCTCTGGGGTTGG + Intronic
902323288 1:15683473-15683495 GTGTCTCGAGTCTCTGAGGAGGG + Intergenic
902414374 1:16230291-16230313 CGGCCTGCAGGCTCTGAGGTGGG + Intergenic
902654145 1:17856166-17856188 TGGTCTGGAGCCTCTGACCTAGG + Intergenic
903541666 1:24099825-24099847 GGGTCTGGAGCCTCTCGGATGGG + Intronic
904600886 1:31672078-31672100 GGGACTGGAGGCTCTGGGGTTGG + Intronic
905703901 1:40040282-40040304 GGGCCAGGATTCTCTGAGGGCGG - Exonic
905788485 1:40776625-40776647 GGGGCTGGAGTCTCAGGGATTGG - Intergenic
907283500 1:53366032-53366054 GCCTCTGGAGTCTCTGAGGGAGG + Intergenic
908323127 1:62997448-62997470 GTGTTTGGGGTCTCTCAGGTGGG - Intergenic
909273117 1:73649697-73649719 GGGTCTGGAGTGTCTGATGTGGG - Intergenic
910647023 1:89525005-89525027 GGGGCTGGAGTCGCGCAGGTAGG + Exonic
910724143 1:90321016-90321038 GGGTCTGGAGTGTCTTAAGTTGG + Intergenic
911199544 1:95031008-95031030 TGGTCTGGAGACTGGGAGGTTGG - Intronic
911598199 1:99820705-99820727 TGGGCTGGAGTCTCTGAGAGTGG - Intergenic
912371297 1:109176206-109176228 GGGTATCGAGGCTCTGATGTGGG + Intronic
914237664 1:145826906-145826928 GGGTCTGAATTCTCAGTGGTAGG - Exonic
916017792 1:160765502-160765524 GGCTCTGGAGTCTCTGGAATTGG - Intergenic
916489508 1:165289055-165289077 GAGGCTGGAGTCTCTGGTGTGGG - Intronic
918076268 1:181173723-181173745 GGAACTGGCGTCTCTGAGGCCGG - Intergenic
919754152 1:201056308-201056330 AAGTCTGGAGTCTCTGAGGAAGG - Intronic
920181567 1:204135015-204135037 GGGGCTGGAGCCTCTCAGGAAGG + Intronic
922028108 1:221772029-221772051 GGGGCTGGAATCTGTGGGGTAGG - Intergenic
923035958 1:230285351-230285373 GGGTGGGGAGTCTAAGAGGTGGG - Intergenic
923743827 1:236682544-236682566 GTAACTGGAGTCTCTGAAGTGGG - Intergenic
1063317542 10:5021089-5021111 GGGTTTGGGGTCTCTGGGGGAGG - Intronic
1069566673 10:69468092-69468114 GGGGCTGGAGTCTCATGGGTGGG - Intronic
1069875781 10:71562108-71562130 GGGCTTGGAGTGTCTGGGGTTGG - Intronic
1071511764 10:86266608-86266630 GGGCCTGGCGGCTCTGAGCTGGG - Intronic
1072907505 10:99467974-99467996 GTTGCTGGAGTCTCTGAGGAGGG + Intergenic
1073031066 10:100526322-100526344 GGGAGTGAAGTCTCTGGGGTAGG - Intronic
1073214261 10:101828019-101828041 GAGGCTGGAGGCTCTGAGGAAGG - Intronic
1073465269 10:103691614-103691636 GGGTCTGGGGTGTCTCAGGCAGG - Intronic
1073479254 10:103775872-103775894 GTGGCTGGAGTCTCTGGGATGGG + Intronic
1073558757 10:104479572-104479594 TGGTCTGGAGTGTCTGGAGTAGG + Intergenic
1074720202 10:116257342-116257364 GGGGCAGGAGTCTCTGTGGCAGG - Intronic
1075274427 10:121080551-121080573 GGTTCTGGTGTCTCTGAAGGAGG - Intergenic
1075298827 10:121302125-121302147 GGGTCTGAGGCCTCTGAGATAGG + Intergenic
1077439831 11:2562628-2562650 GGGCCTGGAGACTCTGAAGAGGG - Intronic
1077742534 11:4862626-4862648 TGGTCTGGGAGCTCTGAGGTTGG + Intronic
1081868339 11:46371888-46371910 GGCTCTGGGGCCTCTGAGGAAGG + Intronic
1083087131 11:60160940-60160962 AAGTTTGGAGTCTCGGAGGTGGG - Intergenic
1083311133 11:61784349-61784371 GGGTGTGGAGACTCTGTGGAAGG - Exonic
1083477096 11:62921706-62921728 GGGGCTGGGGGCTCTAAGGTTGG - Intronic
1084500116 11:69530376-69530398 GGGTCTGGAGCCTCCGAAGGTGG + Intergenic
1087771971 11:102220653-102220675 GGGTCTGGAGTCTCTGAGGTTGG + Intronic
1088785476 11:113177796-113177818 GAGCCTGGAGCCGCTGAGGTGGG + Intronic
1090206529 11:124887359-124887381 GGGTCTGTTGACTCTGAGTTGGG + Exonic
1090331809 11:125938681-125938703 GGTGCTGGGGTCTCTCAGGTAGG - Intergenic
1090500434 11:127255590-127255612 GGGTCTGGAATGTCTGAGCTGGG + Intergenic
1093431153 12:19086653-19086675 TGCTCGGGAGACTCTGAGGTGGG - Intergenic
1095397889 12:41781292-41781314 GGATGTGGAGTCTGTGTGGTTGG - Intergenic
1097929913 12:65171085-65171107 GGGACAGGAGTATCTGAGGATGG + Exonic
1099525989 12:83719967-83719989 GGTTTTGGAGTTTCTGGGGTTGG + Intergenic
1103341860 12:120225054-120225076 GGGCCTGGAGCCTCTGGGGCCGG - Intronic
1104889330 12:132132777-132132799 GGGTCTGGCGTCTCTGAGCCAGG - Intergenic
1104933612 12:132353158-132353180 GGCTCAGGAGGCTCTGAGGGAGG + Intergenic
1106656541 13:31752795-31752817 GGGGCTGGCATCTCTGAGGGGGG - Intronic
1108429227 13:50337166-50337188 GGTACTGGTGTCTCTGAGCTTGG + Intronic
1108524001 13:51270136-51270158 GGGTCTGGGGTCTCTGATTCAGG - Intronic
1110817695 13:79880000-79880022 GGGTCTAGAGTACCTTAGGTTGG - Intergenic
1110887133 13:80654659-80654681 GGGGCAGCACTCTCTGAGGTGGG + Intergenic
1111539990 13:89657224-89657246 GGTACGGGAGTCTCAGAGGTTGG - Intergenic
1113173092 13:107528735-107528757 ATGTCAGGAGTCTCTGATGTAGG + Intronic
1113950645 13:114069542-114069564 GGGTCGGGAGACTCGGGGGTTGG + Intronic
1115507875 14:34110126-34110148 GGGTCTTGAGTCTGTGATGGAGG - Intronic
1116033375 14:39599793-39599815 GGTTCTGGACTCTTTTAGGTTGG - Intergenic
1117920269 14:60721617-60721639 GGGTGTGGAGTTTATGGGGTGGG + Intronic
1118885578 14:69863195-69863217 GGAGCTGGAGTCTAAGAGGTAGG - Intronic
1119193792 14:72702347-72702369 AGGACTGGAGTCTTGGAGGTGGG - Intronic
1119268335 14:73278688-73278710 GGTGATGGATTCTCTGAGGTGGG + Intronic
1119357459 14:74019114-74019136 GTGTCAGGAGTCGCTGCGGTCGG - Intronic
1119476834 14:74935244-74935266 TGGCCTGGAGCCTCTGAGGTGGG + Intergenic
1119717522 14:76869192-76869214 TGGTCTGGAGCCTCTGAGATGGG - Intronic
1121045783 14:90786411-90786433 GGGCCTGGAGCCTCGGAGGGTGG - Intronic
1121177745 14:91903826-91903848 GGACCTGGAGTCTTTGGGGTAGG - Intronic
1121387664 14:93543488-93543510 ATGCCTGTAGTCTCTGAGGTGGG - Intronic
1121495664 14:94390046-94390068 GGGGCTGGTGTCACTGGGGTGGG + Intronic
1122652448 14:103232891-103232913 GGATATGGAGTCTCTGAGTGTGG - Intergenic
1122683031 14:103481158-103481180 AGGTGTAGAGACTCTGAGGTGGG + Intronic
1128088526 15:64903071-64903093 GGGTCTGTATTTGCTGAGGTAGG - Intronic
1128234504 15:66058616-66058638 AGGTCTAGAGGCTCTGAGGAAGG + Intronic
1128608155 15:69053797-69053819 GGGTATGGTGACTCTGAGGGAGG + Intronic
1128779721 15:70351434-70351456 GGGTTTGCAGCCTCTGAGGCTGG - Intergenic
1129237045 15:74229924-74229946 GGATCTGATGTCCCTGAGGTCGG + Intergenic
1133275348 16:4634868-4634890 GGGCCTGGCATCCCTGAGGTGGG + Intronic
1135598332 16:23760493-23760515 AGGTCTAGTGTCTCTTAGGTTGG - Intergenic
1135680342 16:24451050-24451072 GGGTGTGGGGTCTTTGAGATGGG - Intergenic
1135936759 16:26787086-26787108 GGGGTTGGAGTTTCTGCGGTGGG - Intergenic
1136372659 16:29845962-29845984 GGAGCTGGAGGCTCTGAGGTGGG + Exonic
1136547700 16:30965024-30965046 GGGGGTGGAGCCTCTGAGGCAGG - Exonic
1137628250 16:49923021-49923043 GGCTCTGGTCTCTCTGAGGCTGG - Intergenic
1139203012 16:64998506-64998528 AGGCCTGGTGTCTCTGTGGTGGG - Intronic
1141285016 16:82663411-82663433 GCGTGTGGATTATCTGAGGTCGG - Intronic
1141438648 16:84015224-84015246 GGATCTGGAGTCTCTGTTCTGGG + Intronic
1141680928 16:85543468-85543490 GGGTGTGGACTCTATGGGGTGGG - Intergenic
1141761997 16:86034622-86034644 CTGTCTGGAGGCTCTGAGGGAGG - Intergenic
1141862703 16:86728843-86728865 GGGTCTGTGGTCCCTGAGTTTGG + Intergenic
1142622575 17:1174246-1174268 GCTGCTGGAGTCTCAGAGGTGGG - Intronic
1142781016 17:2181276-2181298 TGATCTGAAGACTCTGAGGTGGG + Intronic
1147425632 17:40344764-40344786 GGGTCCTGAGGCTGTGAGGTTGG + Intronic
1147568477 17:41552284-41552306 GGGGCAGGAGCCTCTGAGGTGGG + Intergenic
1147763189 17:42814519-42814541 GGGTCTGAAATTTCAGAGGTAGG - Exonic
1148206946 17:45784936-45784958 GGGACTGGAGACTCTGAAGCGGG + Intronic
1148694349 17:49550057-49550079 CACTCTGGAGTCCCTGAGGTTGG + Intergenic
1149227143 17:54486360-54486382 GGAACCTGAGTCTCTGAGGTGGG - Intergenic
1151820353 17:76493607-76493629 GGGGCTGGGGACTCTGAGGGTGG + Intronic
1152584340 17:81182308-81182330 GGGTATGGGGTCTCAGAGCTCGG + Intergenic
1154358158 18:13638346-13638368 GGGTAAGAAGTCTCTGAGGTAGG - Intronic
1155142215 18:23053832-23053854 GGGGCTGGTGTCTCTGAGGTTGG + Intergenic
1157188075 18:45557672-45557694 GGGCCTGGAGTTTGTGAGTTAGG + Intronic
1158340998 18:56466011-56466033 GGTGCTGGTGTCTCTGAGCTGGG - Intergenic
1160443730 18:78911996-78912018 GGAGCTGGAGACCCTGAGGTGGG - Intergenic
1160845849 19:1165721-1165743 GGGTCTGGAGTCTGAGATCTGGG - Intronic
1160885477 19:1344919-1344941 GGGTCTGGGTTCTCTGTGGCAGG + Intergenic
1161322669 19:3648563-3648585 GGGTCTGCAGTCCCACAGGTGGG - Intronic
1161712992 19:5860299-5860321 GGGACTGGAGTCTCCCAGGCAGG + Intergenic
1161913256 19:7210470-7210492 GGTTCTGGAGTCTCAGTGTTTGG + Intronic
1162381059 19:10332380-10332402 GTGTCTGCAGTCTCTCAGCTGGG - Intronic
1162493972 19:11012866-11012888 GTGTCTTGACTCTCTGAAGTGGG + Intronic
1163749427 19:19066848-19066870 GGGTCTGAAGTGTCTGAGCACGG - Intronic
1164645873 19:29858497-29858519 GGGTCTGGATTCTCTGGATTTGG - Intergenic
1165785202 19:38457681-38457703 GGGTGTGGAGTCTCTAAGTCAGG - Intronic
1166300822 19:41911313-41911335 GGGTCTGGGGTCTCTGAGGAGGG - Intronic
1166504448 19:43362239-43362261 GGGCCTGGAGTCTCTCACTTGGG + Exonic
1166781789 19:45346924-45346946 GGGTCTGGGGGCTCTGTGGAGGG - Intronic
1167149398 19:47700061-47700083 GAGTCTGAAGTCTCTAGGGTAGG + Intronic
1167578886 19:50330744-50330766 GGGCTAGGAGTCTCAGAGGTCGG + Intronic
1168180869 19:54662374-54662396 GGGACTGGTGGCTTTGAGGTTGG + Intronic
1168293096 19:55366470-55366492 GGGGCTGGAATCTCAGAGCTGGG + Intronic
926314506 2:11699424-11699446 GGGTATGGAGTCCCTGGGGGGGG + Intronic
930585183 2:53259772-53259794 GGCCCTGCAGTCTCTGAGGCCGG - Intergenic
932336340 2:70933330-70933352 TGGTCACGAGTCTCTGAGCTGGG - Exonic
933327125 2:80852347-80852369 GGGGCTGGTGTCTCTGATCTTGG + Intergenic
934065248 2:88334509-88334531 AGGGCTGGTATCTCTGAGGTGGG + Intergenic
936157381 2:110057265-110057287 TGGTCTGGAGGCTCTAAGGGTGG + Intergenic
936187311 2:110314179-110314201 TGGTCTGGAGGCTCTAAGGGTGG - Intergenic
937279454 2:120707378-120707400 AGGTGTGAAGCCTCTGAGGTGGG + Intergenic
938711489 2:133979407-133979429 TTGTCTGGAGGCTCTGAGGACGG + Intergenic
940600181 2:155848679-155848701 GGGTCTGGCACCTCTGAGGTTGG + Intergenic
940871231 2:158862113-158862135 GAATCTGGTGTCTCTGAGGCAGG + Intronic
941885285 2:170521581-170521603 GGATCTGGGGTCTGTGAGATGGG - Intronic
942515517 2:176748484-176748506 GTGCCTGTAGTCCCTGAGGTGGG + Intergenic
943203566 2:184860880-184860902 GAGTCTTGGGTCTCTGGGGTTGG + Intronic
943395223 2:187325159-187325181 GGGTCTGGAGTTTCTGGAATTGG - Intergenic
948757464 2:240167802-240167824 GGGGCAGGAGGCTCTGAGGAGGG + Intergenic
1168790490 20:572785-572807 GGTGCTGAAGGCTCTGAGGTGGG + Intergenic
1169288973 20:4332593-4332615 CGGACTGGAGTCTTTGAGGGTGG - Intergenic
1172023259 20:31930864-31930886 GAGACGGGAGGCTCTGAGGTTGG + Intronic
1172255569 20:33514452-33514474 GGGTGTTGAGGCCCTGAGGTAGG + Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1172799190 20:37564409-37564431 GGGTCTGGAGTCTTTGAGGTCGG + Intergenic
1173059880 20:39650988-39651010 GTGTCTGGAGTCTCTGTGTCTGG + Intergenic
1173641503 20:44605880-44605902 GGGTCTGGAGTCACCCAGGCTGG - Intronic
1174363847 20:50044388-50044410 GGATGTGGAGACTCTGAGGTGGG - Intergenic
1174764047 20:53235099-53235121 GGGTCTTGGGTCTCTGAGCTTGG + Intronic
1175598255 20:60252794-60252816 GGATGTGGGGTCTCTGAGTTGGG + Intergenic
1176197566 20:63844463-63844485 GGGTCTGGGGGCTATGAGGCAGG - Intergenic
1177812741 21:25942131-25942153 GGGTGTGGAGTCTTTGAGCTTGG + Intronic
1178311100 21:31530732-31530754 GGGTCCGGGGTCTTGGAGGTTGG - Intronic
1178511448 21:33208005-33208027 GGGTGTGGAGTAACTGAGGGTGG + Intergenic
1179647005 21:42782191-42782213 GGGTCAGGAGTTTCTGAGCCTGG + Intergenic
1179708959 21:43200931-43200953 GTGCCTGTAGTCCCTGAGGTGGG - Intergenic
1179929424 21:44557595-44557617 GGGCCTGGAGACGCTGAGGCTGG + Intronic
1180041421 21:45282223-45282245 GGGTCCGCTGTCTGTGAGGTGGG + Intronic
1180963904 22:19775874-19775896 GGGTCTGGCTGCTGTGAGGTGGG + Intronic
1180984732 22:19897680-19897702 GAGTTGGGGGTCTCTGAGGTGGG + Intronic
1181343455 22:22200591-22200613 GTGGCAGGTGTCTCTGAGGTAGG - Intergenic
1181564532 22:23726897-23726919 GGGTGTGAAGTCTCTAAGGCAGG - Intergenic
1181801134 22:25348658-25348680 GGGTCTGGAGGCAGTGGGGTGGG - Intergenic
1182127851 22:27829222-27829244 TGGGCTGGATTCTCTGGGGTGGG - Intergenic
1182230072 22:28831215-28831237 GGTGCTGTTGTCTCTGAGGTGGG + Intergenic
1182230108 22:28831455-28831477 GGTGCTGGTGTCTCTGTGGTGGG + Intergenic
1182230125 22:28831579-28831601 GGTGCTGGTGTCTCTGTGGTGGG + Intergenic
1182230132 22:28831619-28831641 GGTGCTGGTGTCTCTGTGGTGGG + Intergenic
1183195185 22:36348851-36348873 GGGTCTGAGGGCTCCGAGGTGGG - Intronic
1183320944 22:37164696-37164718 GCCTCTGGTGTCTCTGAGGTGGG - Intronic
1183758406 22:39792350-39792372 GAGTCTAAAGTCTCAGAGGTGGG - Intronic
1184408227 22:44312261-44312283 GGGACTGCAGACTCTGAAGTGGG + Intronic
1184681683 22:46075512-46075534 ATGTTTGAAGTCTCTGAGGTGGG - Intronic
1184993499 22:48186035-48186057 GGGTGTGGAGTCTCAGGGTTTGG - Intergenic
1184995630 22:48205511-48205533 GGGTCAGGAGGGTCTGAGTTAGG + Intergenic
1185280668 22:49968601-49968623 GGGCCTGGAGGCTCTGTGGAGGG - Intergenic
949325383 3:2857687-2857709 GAGTCTGGAGAGGCTGAGGTGGG - Intronic
950431135 3:12951894-12951916 GCGTCTGGAGGCTCTGAGCACGG - Intronic
952942751 3:38455890-38455912 GGGTCTGGAGGCAGTCAGGTGGG - Intronic
954147893 3:48643263-48643285 GTGGCTGGAGTCTGTAAGGTCGG + Intronic
954464440 3:50646243-50646265 TGGTCAGAAGTCTCTGAGGATGG + Exonic
956788618 3:72662987-72663009 GGGACTAGACTCTCAGAGGTCGG + Intergenic
957521794 3:81328004-81328026 GTGTCTGGAGACTATGAGATAGG + Intergenic
959068140 3:101678057-101678079 GGGTCTGTAGTCTCTGGGTGAGG + Intergenic
959905052 3:111702088-111702110 GGGACTGAAGTCTCTGAAGGTGG + Intronic
960732474 3:120742426-120742448 GTGTCTGGAGCCCCAGAGGTAGG + Intronic
960988767 3:123297121-123297143 TGATCTGTAGTCTCTGTGGTTGG - Intronic
961206187 3:125083786-125083808 GGGTCTTGAGTTTCTCAGGTTGG + Exonic
964514182 3:157489308-157489330 TAGGCTGGAGTTTCTGAGGTCGG - Intronic
965853572 3:173061326-173061348 GGGTCCTGTGTCTCTGAGTTGGG + Intronic
966217472 3:177518339-177518361 GAGTCTAGAGTCTGTCAGGTTGG + Intergenic
968085360 3:195871686-195871708 GGGTCAGGAGCTTCTGAGGATGG - Intronic
968621097 4:1603817-1603839 GGGTGTGGAGCCTCAGAGGCTGG + Intergenic
968730797 4:2268402-2268424 GGGACTGCAGTCTCTGGGTTGGG - Intergenic
968812564 4:2806603-2806625 GGGGCTGGAGACGGTGAGGTGGG - Intronic
968966210 4:3770199-3770221 AGCCATGGAGTCTCTGAGGTGGG - Intergenic
969537202 4:7763725-7763747 GGGTGTGCAGTCTCTGAGGCTGG + Exonic
969626639 4:8309008-8309030 GGGACGGGGGTCTCTGAGCTTGG + Intergenic
969860752 4:10033749-10033771 GGGGCTGGGGACGCTGAGGTGGG + Intronic
969974209 4:11081543-11081565 GGGTTTGGAGCCACTGAGGTGGG - Intergenic
970403312 4:15738465-15738487 GGGTGAGGAGTCTATGATGTTGG + Intergenic
972436080 4:39036810-39036832 GGCTGTGGTGTCTCTGAGGCTGG + Intergenic
974144255 4:57926796-57926818 GTGTCTGGTGGCTCTGATGTAGG - Intergenic
975319723 4:72996227-72996249 TGGTCTTGAGTCTCTGGGGGTGG - Intergenic
975683221 4:76896789-76896811 GGGTCTGGCGGCTCTGAATTAGG + Exonic
976334440 4:83869313-83869335 CCCTCTGGAGGCTCTGAGGTAGG - Intergenic
976597614 4:86908796-86908818 GGGTCTGAATTCTCAGACGTCGG + Intronic
977148314 4:93475139-93475161 GCCTCTGGAGTCACTGAGTTAGG - Intronic
983844876 4:172505755-172505777 GGGTCTGGACTTTCAGAGCTTGG + Intronic
985766620 5:1783289-1783311 GAGTCTGGAGGCTCTGAGTTTGG + Intergenic
985977102 5:3428698-3428720 GGCCCTGGTGTGTCTGAGGTGGG - Intergenic
988470340 5:31531910-31531932 GGGGCTGGAGTCTCCGGGGCTGG - Intronic
992886250 5:81162972-81162994 GGGGCTGCTGTCTCTGTGGTGGG + Intronic
998140092 5:139694868-139694890 GAGTCTGGATTTTCTGAGGGGGG + Intergenic
998583581 5:143404064-143404086 GGGTCTGGAGCCGCGGAGCTGGG - Intronic
999685424 5:154098416-154098438 TGGCCTGGAGTCAGTGAGGTGGG + Intronic
1000010123 5:157223239-157223261 GGGTCTGGAGTGCCTGAGATGGG - Intronic
1001241924 5:170077824-170077846 GGGACTGACCTCTCTGAGGTAGG - Exonic
1002090082 5:176799184-176799206 GGCTCTGCCTTCTCTGAGGTGGG - Intergenic
1002473353 5:179450658-179450680 GGGCCTGGAGTCTGGGAGGGAGG - Intergenic
1002480783 5:179499374-179499396 GGGCCTGGAGTCTGGGAGGGAGG + Intergenic
1002923803 6:1593420-1593442 GGGTCTGGGGTCCCTTTGGTTGG - Intergenic
1007222011 6:40286254-40286276 AGCTCAGGAGTCTCTTAGGTTGG + Intergenic
1007297735 6:40839458-40839480 GGGTTTGGAGTCTCAGTAGTGGG - Intergenic
1007586048 6:42990076-42990098 GGGGCTGGTGTCCCTGAGTTGGG + Intronic
1007836744 6:44679777-44679799 GGATCTGCAGTCCCAGAGGTGGG + Intergenic
1012180788 6:96150092-96150114 GGGTCTTGATTCTCTTAGGACGG + Intronic
1013308963 6:108875457-108875479 TGGTATGGAGGCTCTAAGGTAGG - Intronic
1015582997 6:134746600-134746622 GAGTCTCCAGTCTCTAAGGTTGG - Intergenic
1019985206 7:4650584-4650606 GGGACAGGAGACTCTGAGGCTGG - Intergenic
1019989439 7:4681881-4681903 GGGCCTGGAGTGTCTGGGGCGGG + Intergenic
1021295421 7:18900429-18900451 AGGTAAGGCGTCTCTGAGGTTGG - Intronic
1022143973 7:27518554-27518576 TGCTCTGGAGTCTCTGGGATTGG + Intergenic
1022535480 7:31095840-31095862 GGGTCTGGGGCCTCTGCGGGGGG + Intronic
1023365297 7:39457854-39457876 GGGTCTGGCCTCTCTGAGAGAGG - Intronic
1023564750 7:41513028-41513050 GTGGCTGGATTATCTGAGGTCGG + Intergenic
1024953571 7:54892018-54892040 GGCTCTGGCTTCTCTGAGATAGG - Intergenic
1026556882 7:71416117-71416139 GGGGCTGGAATCTGGGAGGTGGG + Intronic
1030259162 7:107544191-107544213 GGGCCTGGAGTCTGTGAGTCAGG - Intronic
1033282956 7:140018562-140018584 GGTTCTGGAGTGTGTGATGTGGG - Intronic
1038687365 8:29730611-29730633 AGGACTGGAGTCTCTGGGGATGG + Intergenic
1039252241 8:35679450-35679472 AGGTATGAAGGCTCTGAGGTTGG + Intronic
1040912994 8:52540613-52540635 GGCTCTAGAGTAACTGAGGTGGG - Intronic
1041527313 8:58821921-58821943 GAGTCTGTAGTCTCTGGGGCGGG - Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1043942050 8:86206860-86206882 GGTTCTGGAGTCACAGAGTTTGG + Intergenic
1044463675 8:92479092-92479114 GGGTTTGGAGTCTATGAGCAAGG + Intergenic
1044638421 8:94352623-94352645 GGGACTGCAGCCTCTGTGGTTGG + Intergenic
1045138502 8:99250794-99250816 TACTCTGGAGGCTCTGAGGTGGG - Intronic
1048303508 8:133267768-133267790 GGACCTGGAGGCTCGGAGGTTGG - Intronic
1049367409 8:142247156-142247178 AGGTCTGGAGTCTCGGCGGTGGG - Intronic
1049769692 8:144374149-144374171 GGGTCTCGGGTCTCTGGGGCTGG - Intronic
1051120198 9:13744386-13744408 AGGTCTGGAGACTCTCAGGCTGG + Intergenic
1051195720 9:14561435-14561457 GGGAGTGGGCTCTCTGAGGTGGG + Intergenic
1053272362 9:36759180-36759202 GTGTCTGGAGCCTCTGGGGAGGG + Intergenic
1054631878 9:67453440-67453462 GGGTATGGAGTCTCTGTGTGTGG + Intergenic
1055059305 9:72052184-72052206 GGGTCTGAGGTTTCTGAAGTGGG + Exonic
1055411716 9:76037551-76037573 GGATATGGATTCTTTGAGGTTGG + Intronic
1055909200 9:81327582-81327604 GGGGATGGAGTGGCTGAGGTAGG + Intergenic
1057407105 9:94782501-94782523 GGGTCTGGACTCTCAGATCTTGG - Intronic
1057798077 9:98172345-98172367 GGGTGTGGGGTCTCAGAAGTGGG - Intronic
1057798110 9:98172466-98172488 GGGTGTGGGGTCTCAGAAGTGGG - Intronic
1059435149 9:114271624-114271646 GGGTCTGGAGAGTCAGAGGGAGG - Intronic
1060541865 9:124436404-124436426 GTGTCAGGAGTCACTGAGGCTGG - Intergenic
1060597330 9:124856345-124856367 GGGTATGGGGCCACTGAGGTGGG - Intronic
1062024440 9:134333779-134333801 GTGGCTGGAGTCGCTGGGGTGGG + Intronic
1062137878 9:134939216-134939238 GGGCCTGGAGGCTGTGAGGAGGG - Intergenic
1062250904 9:135592974-135592996 GGGGCTGGGGTCTCAGAGGCTGG + Intergenic
1062685024 9:137808085-137808107 GGGTCTGGAGCCACCGAGGCAGG + Intronic
1185778490 X:2825431-2825453 AGGGCTGGATTCTCTGAGGTGGG - Intergenic
1186111143 X:6257200-6257222 AGGTCTGAAGTCACTGGGGTAGG + Intergenic
1186254759 X:7706724-7706746 TGTTCTGGAATCTCTGAGCTTGG - Intergenic
1188236792 X:27741344-27741366 GGGTCTGGTGGCTCTGGGGAGGG - Intronic
1190881516 X:54495565-54495587 GGGGCTTGAGTCTCTGCAGTGGG - Exonic
1190952870 X:55163044-55163066 GGGGCTGCATTCTCTGAGGAAGG + Intronic
1192945026 X:75957291-75957313 GGGTTTGGAGTGTCTGAGCTCGG + Intergenic
1196483791 X:116181032-116181054 GGTTCTGGAGTTTCTGAAGTTGG + Intergenic
1197127114 X:122959674-122959696 GGGGCTGGGGGCTCTGAGGGAGG - Intergenic
1198180481 X:134203043-134203065 GGGCCTGGAGTTTCTTTGGTGGG + Intergenic
1198628349 X:138604948-138604970 GGGGGTGGAGCATCTGAGGTCGG + Intergenic