ID: 1087777324

View in Genome Browser
Species Human (GRCh38)
Location 11:102268510-102268532
Sequence CGCAGAAGTCAGTCAGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087777324_1087777336 10 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777336 11:102268543-102268565 GAACGGTGGGTCCCAGATTTGGG No data
1087777324_1087777335 9 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777335 11:102268542-102268564 GGAACGGTGGGTCCCAGATTTGG No data
1087777324_1087777332 -7 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777332 11:102268526-102268548 TTCTGCGGGGCTGGAGGGAACGG No data
1087777324_1087777334 -3 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777334 11:102268530-102268552 GCGGGGCTGGAGGGAACGGTGGG No data
1087777324_1087777333 -4 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777333 11:102268529-102268551 TGCGGGGCTGGAGGGAACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087777324 Original CRISPR CGCAGAAGTCAGTCAGGCCG TGG (reversed) Intergenic
No off target data available for this crispr