ID: 1087777334

View in Genome Browser
Species Human (GRCh38)
Location 11:102268530-102268552
Sequence GCGGGGCTGGAGGGAACGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087777324_1087777334 -3 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777334 11:102268530-102268552 GCGGGGCTGGAGGGAACGGTGGG No data
1087777323_1087777334 3 Left 1087777323 11:102268504-102268526 CCAGCACCACGGCCTGACTGACT No data
Right 1087777334 11:102268530-102268552 GCGGGGCTGGAGGGAACGGTGGG No data
1087777328_1087777334 -9 Left 1087777328 11:102268516-102268538 CCTGACTGACTTCTGCGGGGCTG No data
Right 1087777334 11:102268530-102268552 GCGGGGCTGGAGGGAACGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087777334 Original CRISPR GCGGGGCTGGAGGGAACGGT GGG Intergenic
No off target data available for this crispr