ID: 1087777335

View in Genome Browser
Species Human (GRCh38)
Location 11:102268542-102268564
Sequence GGAACGGTGGGTCCCAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087777323_1087777335 15 Left 1087777323 11:102268504-102268526 CCAGCACCACGGCCTGACTGACT No data
Right 1087777335 11:102268542-102268564 GGAACGGTGGGTCCCAGATTTGG No data
1087777328_1087777335 3 Left 1087777328 11:102268516-102268538 CCTGACTGACTTCTGCGGGGCTG No data
Right 1087777335 11:102268542-102268564 GGAACGGTGGGTCCCAGATTTGG No data
1087777324_1087777335 9 Left 1087777324 11:102268510-102268532 CCACGGCCTGACTGACTTCTGCG No data
Right 1087777335 11:102268542-102268564 GGAACGGTGGGTCCCAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087777335 Original CRISPR GGAACGGTGGGTCCCAGATT TGG Intergenic
No off target data available for this crispr