ID: 1087779094

View in Genome Browser
Species Human (GRCh38)
Location 11:102284467-102284489
Sequence CAAATTAATCAGAAGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087779094_1087779099 1 Left 1087779094 11:102284467-102284489 CCTACATCCTTCTGATTAATTTG No data
Right 1087779099 11:102284491-102284513 GCTTCGGGGTTTGCTGAAGCTGG No data
1087779094_1087779100 7 Left 1087779094 11:102284467-102284489 CCTACATCCTTCTGATTAATTTG No data
Right 1087779100 11:102284497-102284519 GGGTTTGCTGAAGCTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087779094 Original CRISPR CAAATTAATCAGAAGGATGT AGG (reversed) Intergenic
No off target data available for this crispr