ID: 1087782637

View in Genome Browser
Species Human (GRCh38)
Location 11:102317631-102317653
Sequence GCGCGCGCGCGCGCCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 2, 1: 0, 2: 0, 3: 34, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087782637 Original CRISPR GCGCGCGCGCGCGCCTCCCC TGG Intronic
900180508 1:1309019-1309041 GCTCCCGCCCGCGCGTCCCCGGG + Intronic
900206904 1:1435542-1435564 CCGCTCGTGCGCGCCTCTCCGGG + Intronic
900648136 1:3718192-3718214 GCGCGCCCAAGCTCCTCCCCGGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
901762520 1:11479948-11479970 CCGCGCGCGCGAGGGTCCCCAGG + Intronic
902813426 1:18902423-18902445 GCGCGCGCTCGGGCCGCCCCGGG + Intronic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
903522210 1:23959503-23959525 GCGCGCGGGCTCGCCGCCCTTGG - Intronic
903652369 1:24929917-24929939 GCGCCCGCGCCGGCCGCCCCCGG - Intronic
903939776 1:26921705-26921727 ACGCACGCGCGCGGCTGCCCAGG - Exonic
904045155 1:27604183-27604205 CCGCGCGCGCGCTCCCCCCTGGG - Intronic
904045159 1:27604192-27604214 GAGCGCGCGCGCGGCACGCCGGG + Intronic
904384947 1:30135017-30135039 GCCCCCGCACCCGCCTCCCCTGG - Intergenic
904528721 1:31154808-31154830 GCCCGCACACCCGCCTCCCCCGG + Intergenic
904642136 1:31938622-31938644 GCGTGGGCGAGCGACTCCCCAGG - Intronic
907767317 1:57424026-57424048 GCGCTCGCCCGGGCTTCCCCGGG - Exonic
908501102 1:64744876-64744898 GCGCCCGCGCCCGCCTCTCGCGG - Intergenic
908703855 1:66930135-66930157 CCGCGCGCGCGCCCCTGCTCCGG + Intronic
910408419 1:86914647-86914669 GCGGCCGCGCGCCCCTCCACCGG - Intronic
910533951 1:88275030-88275052 GCGCGCGCGCGCGCGCGCCTGGG + Intergenic
914373386 1:147050783-147050805 CCGGGAGCCCGCGCCTCCCCCGG - Intergenic
914803250 1:150975018-150975040 GAGCCCGCACCCGCCTCCCCAGG - Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
915272142 1:154760837-154760859 TCGCGGGCGCGCGCCTCCCTTGG - Intronic
917904485 1:179575683-179575705 GCGGGCGCTCGGGGCTCCCCCGG + Exonic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
920600599 1:207320870-207320892 GCGCGCGCGCGCGCGCCTCGGGG - Intergenic
920600601 1:207320872-207320894 GCGCGCGCGCGCGCGCGCCTCGG - Intergenic
921325570 1:213983910-213983932 GGCCGCGCGCGCGCCTTCCGAGG - Intronic
921384073 1:214551822-214551844 GCGCGCGCCCGCGGCGCCCCCGG - Intronic
922196511 1:223364278-223364300 GGGCGCGCGGGCGCCTCCGCGGG - Intergenic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1062767089 10:74173-74195 TCGCGCGCGCGCGGCCCTCCGGG + Intergenic
1064067475 10:12195018-12195040 GCGCGCGCGCGCCACTACGCCGG - Intronic
1064478756 10:15719527-15719549 GTCCCCGCGCGCACCTCCCCGGG + Intronic
1065807635 10:29409680-29409702 GCCCGCACGCCCGCCTCACCTGG - Intergenic
1066726781 10:38403095-38403117 CCGCACGGGCGCGCCTTCCCCGG + Intergenic
1066726789 10:38403120-38403142 CCGCACGGGCGCGCCTTCCCCGG + Intergenic
1068669670 10:59710074-59710096 GCGCACACACGCGCGTCCCCAGG + Exonic
1071086713 10:81874881-81874903 GCGCCCGCTCGCGCCGCGCCTGG - Intergenic
1071526764 10:86363788-86363810 GCGCGGTGGCGCGCCTTCCCCGG - Intronic
1074503275 10:114044636-114044658 GCGCCCGCGCGCGCGTCAGCAGG - Exonic
1074618344 10:115093038-115093060 GCGCGCGCGCCCACCCCGCCTGG - Intergenic
1076117065 10:127907812-127907834 GCGGGCGCCCGCGCCTTCCCAGG + Intronic
1076156599 10:128210345-128210367 GAGGGCGAGCGCGCCTTCCCGGG + Intergenic
1076880523 10:133237308-133237330 GCCCCCGCGCGCCGCTCCCCGGG + Intergenic
1077395049 11:2316516-2316538 GGGTGCGGGCGCCCCTCCCCAGG - Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1082775670 11:57242597-57242619 GCGCGCACGCGCGCGTGCCTAGG - Intergenic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1084065980 11:66704738-66704760 CCGCGCTCGCTCGCCTGCCCGGG + Exonic
1085485643 11:76860871-76860893 GCGCTCGCTCGCGCCCCGCCCGG - Exonic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088920906 11:114259296-114259318 GCCCGCTCGGGCACCTCCCCAGG + Intronic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1090187024 11:124745687-124745709 GCCGCCGCCCGCGCCTCCCCGGG - Exonic
1091286635 11:134411973-134411995 GCGCGCCCGCCCGCCCCGCCCGG + Intergenic
1091402448 12:189194-189216 ACGCGGGCGCGCGCCTCAGCCGG - Intergenic
1091616109 12:2052652-2052674 CCGCGCGCCCCGGCCTCCCCGGG + Intronic
1092204697 12:6607595-6607617 GCGGGCGCGCGCGCGTCACCTGG + Intergenic
1094238048 12:28190715-28190737 GCTCGTCCGCGCTCCTCCCCCGG - Intronic
1095476260 12:42589863-42589885 GCGCGCGCCCACGCGTACCCCGG + Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096782784 12:54000624-54000646 GCGCGGTCGCGCAGCTCCCCGGG - Exonic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098288517 12:68933218-68933240 GCGCGCCCGGGCCCCGCCCCCGG + Intronic
1100992585 12:100267048-100267070 TCGCGCGCTGGCTCCTCCCCTGG + Exonic
1102025824 12:109713961-109713983 GCGCGCGCCGGCGCCTCGCCTGG - Intergenic
1103348370 12:120265798-120265820 GTGCACGCGCGCCCCGCCCCCGG + Intergenic
1103758817 12:123233134-123233156 GGGCGCGCGCGCGCTCCCTCGGG - Exonic
1104444609 12:128823379-128823401 GCGCGGGGGCGCGGCTCACCTGG + Exonic
1104961570 12:132490588-132490610 GCGCGCGCGAGCGCCGGCTCGGG - Exonic
1105322784 13:19344740-19344762 GCGCCCGCGCCCACCTTCCCGGG + Intergenic
1105368523 13:19782595-19782617 GCCCGCGCCCGCGCCTCCAGAGG - Exonic
1105874829 13:24541975-24541997 GCGCCCGCGCCCACCTTCCCGGG - Intergenic
1106264784 13:28100382-28100404 ACCCGGGCGCGCGCCTCCTCCGG - Intronic
1107468031 13:40666657-40666679 GCCGGCGCGCGCGCCGCCGCGGG - Intergenic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1110572973 13:77026688-77026710 GCGCGCGCGGGCCGCTCCTCAGG - Intronic
1111951287 13:94711430-94711452 GCGGGCGCGGGCGCCTTCCACGG - Exonic
1113082337 13:106533270-106533292 GCCCGCCCGCCCGCCTCTCCCGG + Intronic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1114422793 14:22598525-22598547 GCGGGCGAGCGCGTCTCCCATGG - Intronic
1117920529 14:60722737-60722759 GCGTGCGCGCGCGCCAGGCCCGG + Intronic
1118019350 14:61695412-61695434 GCGCGCCCGCTCGCCTGCCCAGG - Intergenic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119385922 14:74258136-74258158 GCGAGCGCCCCCGCTTCCCCGGG - Intronic
1119418662 14:74493401-74493423 GCCCGCCCGCGCCCCGCCCCCGG + Exonic
1121453846 14:94026455-94026477 GAGCCCGCCCGCGCCTCCCGCGG + Exonic
1122221283 14:100240202-100240224 GAGCGCGCCGGCCCCTCCCCCGG - Intronic
1122904469 14:104795501-104795523 GCGCGAGCGCGGGCCTAGCCGGG + Intronic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1126626059 15:50686759-50686781 GCGCCCGCGCCCGCCTCCGCCGG + Exonic
1127931647 15:63600991-63601013 GCGCCCGCGCGCGCCCGCCGCGG + Intronic
1130613468 15:85381269-85381291 GCGCGAGGGAGCGGCTCCCCGGG + Intronic
1131558492 15:93419561-93419583 GCGCGCGCGCGCGCAACCCAGGG - Intergenic
1131827070 15:96330567-96330589 CGGCGCGCGCGCGCCTGGCCAGG + Intronic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132684727 16:1157566-1157588 CCGCCTGCGCCCGCCTCCCCGGG + Intronic
1132841268 16:1979461-1979483 ACGCGCACGCGCGCCCCCGCGGG + Exonic
1133212803 16:4272578-4272600 GCGCACACGCGCGCCCGCCCGGG + Intronic
1133259455 16:4538646-4538668 GCGCGGGAGCCCTCCTCCCCGGG - Intronic
1133305276 16:4804439-4804461 GCGGGCGCTCGCTCCTCCCTAGG - Exonic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1136245798 16:28975126-28975148 GCGGGCGGGCGCGGCCCCCCGGG + Exonic
1136531877 16:30875361-30875383 GCGCGCGCCCGCGCCCCAACCGG + Intronic
1137300254 16:47142989-47143011 CGGCGCCCGCGCGCCGCCCCCGG + Intronic
1137617326 16:49855697-49855719 TCGCTCGCTCGCGCCTCCGCCGG + Intronic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1140462244 16:75148959-75148981 CCGCGCGCGCGCGCCCGCCGGGG - Intronic
1141116612 16:81315015-81315037 GCGCGCGCGCCCGCCCGGCCCGG - Exonic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1142209886 16:88803982-88804004 GCCCGCCCGCCCGCCGCCCCCGG + Exonic
1142347072 16:89560881-89560903 CCGGGCGCGCGCACCCCCCCGGG - Intronic
1143026619 17:3945025-3945047 CCGCCCGCCCGCGCGTCCCCTGG + Intronic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1147015672 17:37489824-37489846 GCGTGCGCGCGGCCCGCCCCGGG + Exonic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1148225200 17:45894469-45894491 GCGGGAACGCGAGCCTCCCCAGG - Exonic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1151557166 17:74852376-74852398 GTGCGCGCGCGCGGCCCTCCCGG + Exonic
1151919149 17:77140880-77140902 CCGCGCACGCGCGCCCCTCCCGG + Intronic
1152212485 17:79009773-79009795 GCGCGCGCTCGCCCCGCCTCTGG + Exonic
1152356752 17:79811276-79811298 GCGCGTGCGCGCGCCTCGGCGGG - Intergenic
1152606699 17:81295067-81295089 GCCCGCGCCCGCGCCTGCTCAGG - Exonic
1152628500 17:81399324-81399346 GCGTGCGCGCGCGGGGCCCCGGG + Intronic
1152852975 17:82648517-82648539 GCGCGCGCCCGCGCCCCACCAGG + Exonic
1153285015 18:3449375-3449397 GCGCGCGCCCGGCCGTCCCCGGG + Intronic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1153480619 18:5543462-5543484 GCGCGGGCCGGCCCCTCCCCCGG - Intronic
1154214820 18:12408168-12408190 GAGGGCACGCGCGCTTCCCCGGG + Intronic
1154241566 18:12657982-12658004 GCGGCCGCGCGCGCCGCCGCCGG + Exonic
1154266517 18:12883704-12883726 GCGCTCGGGCGCGCGCCCCCGGG - Intronic
1154991378 18:21600977-21600999 CCTAGCGCGCGCGCCTCCGCGGG + Intergenic
1157354134 18:46917618-46917640 GCGCCCGCCCGCGCCTGCCCCGG + Intronic
1157833664 18:50879352-50879374 GAGCGGGCGCCGGCCTCCCCTGG + Intronic
1159511519 18:69401863-69401885 GCACGCGGGCGCGGGTCCCCGGG - Intronic
1159586463 18:70288456-70288478 GCGTGCGCGCGCGTCTGTCCTGG + Intergenic
1160156928 18:76441605-76441627 GCCCGCTCGCGCGCTTCCGCGGG + Exonic
1160164077 18:76495164-76495186 GCGTGCGCGTCCTCCTCCCCAGG - Exonic
1160719369 19:590614-590636 CCCCGCGCGCCCGGCTCCCCGGG - Intronic
1161203698 19:3029371-3029393 CCCCGCGCCCGCGCCCCCCCCGG + Intronic
1161444415 19:4310398-4310420 GCGCGAGGGGGCCCCTCCCCAGG - Intronic
1161494961 19:4581600-4581622 GCGCGCGCTCTCCCCGCCCCCGG + Intergenic
1161521045 19:4723655-4723677 GCGCGCGGGCGCTGCTCACCGGG + Exonic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162485960 19:10960842-10960864 GCGCGTGCGCGCCCGTCCCTGGG - Intergenic
1162486012 19:10961019-10961041 GCGCGCGCGCCCGCCCGCCTCGG - Exonic
1162778744 19:12995889-12995911 CCGCGCCCGCTCCCCTCCCCCGG - Intronic
1165236848 19:34428567-34428589 GCGCGCGCCCGGCCCTCACCAGG - Exonic
1166798030 19:45439829-45439851 TCAGGCGCGCGCTCCTCCCCGGG + Intronic
1167579635 19:50333894-50333916 GCGCGGTCTCGCGCCTTCCCAGG + Intronic
1167709932 19:51104335-51104357 GCGCGCGCTGGCGCCGCGCCTGG - Exonic
1168423091 19:56217838-56217860 GCGCGCGCGCACCCCATCCCCGG + Intergenic
1168721037 19:58555162-58555184 GCGCGCGTGCGCCCGTGCCCCGG + Intergenic
925609391 2:5691541-5691563 GCCCCCGCGCGCCCCGCCCCGGG - Intergenic
928093590 2:28391122-28391144 GCGCACGCGCGCGCGTCCTTGGG + Intergenic
929061081 2:37925254-37925276 GCGGCCGCGGGCTCCTCCCCCGG + Intronic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
930872692 2:56184415-56184437 GCGCGCGCCCGCGCTCCCCCAGG - Exonic
931052304 2:58428486-58428508 GCGCGCGCGGCGGCCGCCCCGGG - Intergenic
931649374 2:64454398-64454420 GGGCGCGCGCGCGCGCGCCCGGG - Exonic
932380313 2:71276422-71276444 GCGCTCGCGCCCGCCCCACCAGG - Intergenic
932496535 2:72148476-72148498 GGGCTCGAGCGCGCCGCCCCGGG - Intergenic
937221741 2:120346063-120346085 GCCCGCGCCCGCGCCCGCCCGGG - Intergenic
938895043 2:135741749-135741771 GCGCGCTAGCGCGCGTCTCCGGG + Exonic
942034730 2:171999848-171999870 GCGCGCACGCGCGCTCCCCTCGG + Exonic
944766645 2:202871470-202871492 GCGCGCGCGCGCGGCTTCTCGGG - Exonic
948046916 2:234952082-234952104 GGGGGCGCGCGCGGCTCCGCGGG - Intronic
948118862 2:235514139-235514161 GCGCGCGCACGCGCATGCACTGG - Intronic
948237305 2:236400670-236400692 TGGCGCGGGCGTGCCTCCCCTGG + Intronic
1169800752 20:9509046-9509068 GCGGGCGCGCGGGCCAGCCCAGG + Intergenic
1169849603 20:10035070-10035092 GCCCGCGCGCTCGCCTTCCGGGG + Exonic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1173454048 20:43189619-43189641 GTGCGCCCGCCCGGCTCCCCTGG - Intronic
1173683967 20:44909975-44909997 GCGCTCGGACGCCCCTCCCCCGG - Intergenic
1174386616 20:50191346-50191368 GCCCCCGCGCCCGCCTCCTCCGG + Exonic
1174579587 20:51562385-51562407 GGGCGCGGGCGCCCCTCCGCGGG + Intronic
1175374474 20:58514947-58514969 GCGGGTGTGCGCGCCTCGCCGGG - Intronic
1176156943 20:63626811-63626833 CCGCGCGGCCGCCCCTCCCCCGG + Intronic
1176178534 20:63739513-63739535 GCGCGCCCGCGCGCCCCGCCGGG - Intronic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176207168 20:63895368-63895390 GCCCGCCCGCCCGCCTGCCCGGG - Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1179809975 21:43864655-43864677 TCGCGCGCGAGCTCCTGCCCTGG - Intergenic
1180086825 21:45511268-45511290 GCCCGCCCGCCCGCCTTCCCTGG - Intronic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1181937932 22:26451979-26452001 GCGCGCGCGCGCGCGTAACGTGG - Exonic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
1184164865 22:42721004-42721026 GCGCGCCCTCGCTGCTCCCCGGG + Intronic
1184680788 22:46071337-46071359 CCGCCCGCGCGCGCCGTCCCGGG + Intronic
1184766890 22:46576951-46576973 CCGCGGGGGCGCGCCTGCCCTGG - Intronic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
949559480 3:5188332-5188354 GCGCGTGGGCGCGCGGCCCCGGG - Intronic
949987871 3:9553864-9553886 GCTCGGGAGCGCGCCTCCGCCGG - Intergenic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
954367746 3:50155307-50155329 GCGCTCGGGGCCGCCTCCCCTGG - Exonic
956179085 3:66500924-66500946 GCGCGCGCGCGCGCGCTCTCTGG - Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
962301954 3:134250862-134250884 GCGCGCACGGGCGCGTCCCGCGG - Intergenic
962301958 3:134250877-134250899 GTGCGCGCCGCCGCCTCCCCGGG + Intergenic
963038539 3:141052010-141052032 GCCCCCGCGCGCCCCTCACCAGG - Intronic
964041664 3:152268745-152268767 GCGCCCTCCCGCGCTTCCCCGGG - Exonic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
966181862 3:177196469-177196491 GCTGCCGCGCGCCCCTCCCCCGG + Exonic
966378835 3:179323335-179323357 GCCCGCACGCCCGCGTCCCCTGG - Intronic
966449063 3:180037087-180037109 GGGCACGCGCGCGCGTTCCCAGG + Intergenic
966592230 3:181695790-181695812 ACGCGCGCGCGCGCGTTCTCGGG + Intergenic
966982828 3:185153509-185153531 GAGCGTGTGCGCGCCTCCCAGGG - Intergenic
968092785 3:195909016-195909038 GCGCTCGCGGGGGCCTTCCCCGG + Intronic
968213462 3:196868244-196868266 ACGAGCTCGCTCGCCTCCCCCGG - Intronic
968230719 3:197003244-197003266 GCGGGAGCAGGCGCCTCCCCGGG - Exonic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
968556421 4:1248423-1248445 TCGCGGGAGCGCGCCTCCCGCGG - Intronic
968584068 4:1407817-1407839 GCGAGCGCGCGCGCTTCTTCAGG + Intergenic
968660143 4:1795433-1795455 GCGGGCGGGGGCGCCGCCCCGGG - Intronic
969714449 4:8861499-8861521 GCGCGCGCGTGCATCTGCCCTGG - Intronic
969716770 4:8871687-8871709 GCGCACGCGCGGGCCGGCCCTGG + Exonic
970319707 4:14863053-14863075 GCCCCCGCACGCGCCGCCCCAGG + Intergenic
981429844 4:144646008-144646030 CCCCGCGCGAGCGCGTCCCCCGG - Exonic
982000299 4:151015729-151015751 GCGCACGCGCACGCCGCGCCCGG - Intergenic
982484756 4:155953689-155953711 TACCGAGCGCGCGCCTCCCCGGG - Intronic
984667940 4:182448649-182448671 GCACGCTCGCGAGCCGCCCCGGG - Intronic
990545339 5:56816000-56816022 GCGGGCGCCCGCTTCTCCCCGGG - Exonic
992286114 5:75237003-75237025 GCGCGCGCGCAGGCCTACTCTGG + Intergenic
992837428 5:80654673-80654695 GCGGGCTCGCGCTCCTCGCCAGG + Exonic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998199483 5:140108092-140108114 GCGCGCGCGCACACCTGTCCTGG - Intronic
999223549 5:150001008-150001030 GGGCTCGCGCGCGCATCCCGGGG - Exonic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
999374948 5:151080664-151080686 GCGCACGCGCGCCCCCCACCAGG + Intronic
1002026236 5:176397769-176397791 GCCCGGCCGCGCTCCTCCCCTGG + Intronic
1002185936 5:177454842-177454864 GCGCGCGGGCGTGCCTCACCCGG - Exonic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002632321 5:180590371-180590393 CCGCGCGGGTGCGCGTCCCCCGG - Intronic
1003290703 6:4776334-4776356 GCGCGGGAGCGCGGCTCCGCAGG + Intronic
1004690328 6:17987653-17987675 CCGCGCGCCCGCCCCTCCCCGGG - Intergenic
1004722208 6:18277464-18277486 GAGCGCGCGCGCGCCTTGGCGGG + Intergenic
1006136202 6:31897567-31897589 GCACGGGCGCGCGCTTCCCCCGG + Intronic
1011277301 6:85643347-85643369 GCCCGCGGGCGCGCGTCCCGAGG - Intronic
1014009774 6:116462246-116462268 CCGCGCTCGCGCCCCTCACCTGG + Exonic
1018218183 6:161551278-161551300 GGTCGCCAGCGCGCCTCCCCAGG - Intronic
1019054403 6:169213167-169213189 GCGCGCGGGCGGGGCTCGCCGGG + Intergenic
1019143794 6:169963940-169963962 GCGCGTGCGTGCGCCTCCACGGG + Intergenic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1020066218 7:5190370-5190392 CCTCGCGCGCGCGCCCTCCCCGG + Exonic
1020253006 7:6484199-6484221 GCGCGCGCGCGGGGCACCCTGGG + Exonic
1026822319 7:73557757-73557779 GCGCGCCTGCGCGCCCCGCCCGG + Exonic
1027540079 7:79454477-79454499 GCGCGGGCGGGGGCCTGCCCCGG - Intergenic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029640556 7:101816815-101816837 GCGCCCGCGCTCGCTACCCCCGG + Intronic
1030138738 7:106284675-106284697 GCCGCCGCCCGCGCCTCCCCCGG + Intronic
1033253183 7:139777786-139777808 GCGCGCCCGGCCCCCTCCCCCGG - Intronic
1034147442 7:148884871-148884893 GCCCGCGCCCTCCCCTCCCCGGG - Intergenic
1035160905 7:156949557-156949579 ACCCGCGGGCGCGCCTGCCCCGG + Intergenic
1036830273 8:12015174-12015196 GCGGGCGCGGGCTCCTCCGCGGG + Intronic
1036899350 8:12659473-12659495 GCGGGCGCGGGCTCCTCCGCGGG + Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1039921679 8:41897525-41897547 GCTCCCGCGCACGCCTCCCTGGG + Intergenic
1042399651 8:68331084-68331106 CCACGCGCGCGTGGCTCCCCGGG + Exonic
1042962945 8:74321704-74321726 CCGCGCGCGCCCGCCTGCCGAGG - Intronic
1043502975 8:80874384-80874406 GAGCCCGCGCGCGCCTCTCCCGG + Intronic
1044115311 8:88327743-88327765 GCGCGCGCGCGCGCGCGCCAAGG - Intronic
1045327246 8:101126513-101126535 GCGCTCGCACGCGCCCTCCCAGG + Intergenic
1045509959 8:102806543-102806565 GTGCCCGCCCCCGCCTCCCCCGG + Intergenic
1045847737 8:106657866-106657888 GCGCGCGGAGCCGCCTCCCCTGG + Intronic
1049585496 8:143430785-143430807 GGGGGCGCGCGCCCCTCCCGGGG - Intergenic
1049714284 8:144082628-144082650 GCGGGCGAGCGCGGGTCCCCGGG + Exonic
1050437854 9:5628961-5628983 GCGCGCGCGCGGGCCCTCCCCGG + Intergenic
1055090906 9:72364551-72364573 GCGGGCGGGCTCCCCTCCCCCGG + Exonic
1055158921 9:73100353-73100375 GCGCGCGCGCGCGCGTGCATAGG + Intergenic
1055308217 9:74952268-74952290 GCGCCCGGGAGCTCCTCCCCCGG + Exonic
1056922349 9:90801866-90801888 GCGCCCGCCCTCGCCTCACCTGG + Exonic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1057619106 9:96619421-96619443 GCGCGCCCGCGCGCCCGCCGAGG + Exonic
1057758084 9:97853114-97853136 GGGCCCGGGCGCACCTCCCCAGG - Intergenic
1057995914 9:99821683-99821705 GCGCGCGCGCGCGCGTTCCTCGG - Intergenic
1060514666 9:124258188-124258210 GCGCGCGCCCACGGCTCCGCGGG + Intronic
1061453513 9:130681668-130681690 GAGCGCGCCCGCGCCCCCGCCGG + Exonic
1061666141 9:132161975-132161997 GCGCGGGCGGCCCCCTCCCCCGG + Exonic
1061802813 9:133121333-133121355 GCGCGCACGCACGCGTCCCTCGG - Intronic
1062230529 9:135479626-135479648 GCCGGGCCGCGCGCCTCCCCCGG + Intronic
1062365236 9:136205182-136205204 GCGCGCCCGCCCACCTCCCGGGG + Intergenic
1062551034 9:137086597-137086619 CCCCGCCCGGGCGCCTCCCCGGG + Intergenic
1062558798 9:137130005-137130027 CGGCGCCCGGGCGCCTCCCCGGG - Intergenic
1062621013 9:137422740-137422762 GGGCGCGCGCGCGTCCCACCGGG + Intronic
1062653610 9:137590681-137590703 GCGCGCGCAGGCACCGCCCCCGG - Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203654784 Un_KI270752v1:13035-13057 GCGCACGCGCACGCCCCTCCAGG - Intergenic
1187181375 X:16946669-16946691 GCGCGCGCCGGCCCCACCCCCGG - Exonic
1189528580 X:41854193-41854215 GCGCGCGCGCGCATGTTCCCTGG - Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1195316844 X:103687494-103687516 GCACGCGCGCGCGCCCGCCGTGG - Intronic
1195625184 X:106999833-106999855 GCGCGCGCGTCCGCCCCCTCGGG + Intronic
1195954888 X:110318182-110318204 GGGCGCGCGCGCGCCGCTCCCGG + Exonic
1196819577 X:119692478-119692500 GCGCGCGCTCGTGTCTTCCCGGG - Intronic
1198517483 X:137424656-137424678 GCGCGCCCGCGCGCGTTCGCGGG - Intergenic
1200128968 X:153830808-153830830 GCCCGCGCTCCCGCCTCGCCCGG + Intergenic
1200173799 X:154097792-154097814 GCGCGCCCGCGCCCCGCCCTCGG + Intergenic