ID: 1087786223

View in Genome Browser
Species Human (GRCh38)
Location 11:102357247-102357269
Sequence GAGGGAGTAAGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8819
Summary {0: 1, 1: 15, 2: 175, 3: 1289, 4: 7339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087786223 Original CRISPR GAGGGAGTAAGGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr