ID: 1087789759

View in Genome Browser
Species Human (GRCh38)
Location 11:102393561-102393583
Sequence GTAAAGCCACTGCCATAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087789759_1087789762 12 Left 1087789759 11:102393561-102393583 CCTTACTATGGCAGTGGCTTTAC No data
Right 1087789762 11:102393596-102393618 AGGTGTGCACAGCCCAGCCTTGG No data
1087789759_1087789767 25 Left 1087789759 11:102393561-102393583 CCTTACTATGGCAGTGGCTTTAC No data
Right 1087789767 11:102393609-102393631 CCAGCCTTGGAGTCAGGGCCTGG No data
1087789759_1087789764 20 Left 1087789759 11:102393561-102393583 CCTTACTATGGCAGTGGCTTTAC No data
Right 1087789764 11:102393604-102393626 ACAGCCCAGCCTTGGAGTCAGGG No data
1087789759_1087789761 -8 Left 1087789759 11:102393561-102393583 CCTTACTATGGCAGTGGCTTTAC No data
Right 1087789761 11:102393576-102393598 GGCTTTACTGTTTGCGGTATAGG No data
1087789759_1087789763 19 Left 1087789759 11:102393561-102393583 CCTTACTATGGCAGTGGCTTTAC No data
Right 1087789763 11:102393603-102393625 CACAGCCCAGCCTTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087789759 Original CRISPR GTAAAGCCACTGCCATAGTA AGG (reversed) Intergenic
No off target data available for this crispr