ID: 1087792634

View in Genome Browser
Species Human (GRCh38)
Location 11:102423049-102423071
Sequence CACCTTTAGCAGCTTGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087792634 Original CRISPR CACCTTTAGCAGCTTGAGCT AGG (reversed) Intronic
901295331 1:8156801-8156823 GACCTCTAGGAGCTTGTGCTAGG - Intergenic
905011207 1:34748128-34748150 CACTTTTAGCACCTGGAGCCTGG - Intronic
907313313 1:53552236-53552258 CACCTATAGCAGCTTAGGGTTGG - Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912841203 1:113041179-113041201 CCTCTTTGGCAGCTTGATCTTGG - Intergenic
914003139 1:143709598-143709620 CACCTTTAGAAACATCAGCTGGG - Intergenic
914094347 1:144532084-144532106 CACCTTTAGAAACATCAGCTGGG - Intergenic
914304174 1:146401804-146401826 CACCTTTAGAAACATCAGCTGGG + Intergenic
915235030 1:154474197-154474219 CACGTTTATCAGTGTGAGCTGGG + Intronic
915354361 1:155247326-155247348 CACCTCTAGCTGCATGACCTTGG - Exonic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
920791112 1:209093842-209093864 CACCTTTAGAAGCAAGAGATAGG - Intergenic
922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG + Intronic
923483244 1:234404394-234404416 CAACTTTGGTAGCTTGAGTTTGG + Intronic
924291790 1:242543875-242543897 CACCTGTAATTGCTTGAGCTTGG + Intergenic
1063649142 10:7915730-7915752 CACCTTTGGGAGGTTGAGGTGGG + Intronic
1065626515 10:27635034-27635056 CATTTTTAGCAGCCTGAACTTGG + Intergenic
1066043288 10:31574491-31574513 CACCTTGTTCAGCTTCAGCTGGG - Intergenic
1075324484 10:121519976-121519998 CACCTTGAGAACCTTGAGGTAGG + Exonic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1077005436 11:353229-353251 CACCAATAGCAGCTCGGGCTGGG - Intergenic
1082686930 11:56250053-56250075 CATGTTTAGCAGCATAAGCTTGG - Intergenic
1086797925 11:91132257-91132279 CAGATTTAGCAGCTTGTGTTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088545765 11:110957213-110957235 CCTCATTAGCAGCTTGTGCTAGG - Intergenic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1092407180 12:8229306-8229328 CACCTTAAGCCACTTGTGCTTGG + Intergenic
1100612383 12:96202239-96202261 CACATCTTGCAGCTTGAGTTAGG - Intronic
1102989322 12:117303505-117303527 CACCTTTACCAGCTAGAGGCTGG + Intronic
1103336527 12:120194435-120194457 CGACTTCAGCAGCTGGAGCTCGG - Intronic
1106705597 13:32275742-32275764 CATCATTTGCAGTTTGAGCTGGG - Intronic
1112806758 13:103171470-103171492 CACCTTTATCAGATTCACCTAGG - Intergenic
1113022747 13:105906364-105906386 CACCTGAAGCAACTGGAGCTGGG + Intergenic
1113636729 13:111924629-111924651 AACCTTTCGCTGCATGAGCTTGG - Intergenic
1113812092 13:113149174-113149196 CACCTCCAGCATCTTGAGCCTGG - Exonic
1120016408 14:79478951-79478973 CACCTTTTGGAGCTTCAGTTTGG + Intronic
1120176928 14:81304411-81304433 CATCTCTAACAGCGTGAGCTTGG - Intronic
1123469006 15:20536339-20536361 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123649052 15:22464352-22464374 CACCTGTGGCAGCAGGAGCTTGG - Exonic
1123729282 15:23131327-23131349 CACCTGTGGCAGCAGGAGCTTGG + Exonic
1123747450 15:23328809-23328831 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124279811 15:28352661-28352683 CACCTGTGGCAGCAGGAGCTTGG + Intergenic
1124302887 15:28558943-28558965 CACCTGTGGCAGCAGGAGCTTGG - Intergenic
1125200440 15:37097504-37097526 CACTAACAGCAGCTTGAGCTGGG - Intronic
1126381556 15:48052959-48052981 TGACTTAAGCAGCTTGAGCTGGG - Intergenic
1126544657 15:49860214-49860236 CACCGTGAGCAGCTTTAGCCAGG - Exonic
1128800863 15:70496080-70496102 CACCTGTAGAAGCTGCAGCTGGG - Intergenic
1134104411 16:11475777-11475799 CACCTTGAGCTGCCAGAGCTTGG + Intronic
1135143737 16:19943610-19943632 CAGCTTTAGAAGTTTGAACTGGG - Intergenic
1136121532 16:28138943-28138965 CACCTTTGTCATCTTGAGGTTGG - Intronic
1142239515 16:88938849-88938871 CACCGTTAGCAGGTTGACTTTGG - Intronic
1149656302 17:58311142-58311164 CACCTGCAGCAGCTGCAGCTGGG + Exonic
1150809833 17:68347633-68347655 CAGCTTTGGTAGCTTGATCTTGG - Intronic
1156030567 18:32707749-32707771 CACTCTTGGAAGCTTGAGCTGGG + Intronic
1158332376 18:56376734-56376756 CCCCTTTAGCAGAGTCAGCTTGG - Intergenic
1166459527 19:42973857-42973879 CACCTCTATCACCTTGGGCTTGG - Intronic
1166476845 19:43133902-43133924 CACCTCTATCACCTTGGGCTTGG - Intronic
1167286239 19:48600172-48600194 CAGCTCTAGCAGCTCTAGCTCGG + Intergenic
925721453 2:6832206-6832228 CATCTTTAGCAGCTTTATCGAGG - Intergenic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
931957309 2:67441711-67441733 CAAAGTTAGCAGCTTGTGCTTGG - Intergenic
932579262 2:72982998-72983020 CACCTGTGGCAGCTTGTCCTGGG - Intronic
937182496 2:120009205-120009227 CACCCTTAGCATGTTGACCTTGG - Intergenic
939468552 2:142589683-142589705 CACATTCAGCAACTAGAGCTGGG + Intergenic
943570258 2:189565402-189565424 CAGCTTTCACAGCTAGAGCTGGG + Exonic
948610920 2:239166417-239166439 CATCTTCAGCAGCATGAGCTGGG - Intronic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1172602602 20:36194341-36194363 TACCTTTAGCTCCTTGATCTTGG - Exonic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1180274280 22:10631158-10631180 CACCTTTCGCAGTTTGGGGTGGG + Intergenic
1180799784 22:18626355-18626377 CACCTTGAGAAGCTGCAGCTGGG - Intergenic
1181221931 22:21368911-21368933 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181637322 22:24180550-24180572 CACCTTGAGAAGCTGCAGCTGGG + Intergenic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1183759666 22:39804742-39804764 CATCTTTAGGAGCCTGTGCTTGG - Intronic
961929860 3:130521880-130521902 CACTATGAGCAGCTGGAGCTCGG - Intergenic
963905164 3:150767566-150767588 CACCTGTGGCACCTTGACCTTGG - Intergenic
965750260 3:171968543-171968565 CACCTAGTGCAACTTGAGCTTGG + Intergenic
965845041 3:172951678-172951700 CACCTCTGCCAGCTTGTGCTGGG + Intronic
967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG + Intronic
967336721 3:188352331-188352353 CACCTTTGGCAGCTTGTGAGCGG + Intronic
973117259 4:46477198-46477220 CATGGTTAACAGCTTGAGCTTGG - Intergenic
973958402 4:56086387-56086409 CACTTTTAGGAGCCTGAGGTAGG - Intergenic
974981271 4:68960267-68960289 CACCTTCAGGAGCTGCAGCTGGG + Intergenic
975065831 4:70062406-70062428 CATCTTCAGGAGCTTTAGCTGGG - Intergenic
975798049 4:78030589-78030611 CACATTTAGTAACTTGAGGTGGG + Intergenic
976568821 4:86584844-86584866 CACCAATAGCAGCTTGAATTGGG - Intronic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
978852154 4:113352013-113352035 CACCTTCAGCAGCTTATGCATGG + Intronic
979867419 4:125774189-125774211 AACCTTTAACAGCTTGAAATAGG + Intergenic
982243490 4:153324783-153324805 CACCTTGAGAAGCCTGATCTAGG - Intronic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
994231713 5:97315587-97315609 CTCCTTTAGCTGCTTGAGGAAGG + Intergenic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
1004207736 6:13608004-13608026 CACTTTTAGGAGCTTGAGCTAGG - Intronic
1005583633 6:27255269-27255291 CTCCTTTGCCAGCTTGAGCCAGG - Exonic
1005994672 6:30923955-30923977 CTCCTTTAGCAGGTTGGGGTGGG + Intronic
1013384661 6:109614192-109614214 CAACTTTAGCAGCTTGATCATGG + Exonic
1013643639 6:112113327-112113349 CAGCTTTTGCAGCTGGAACTTGG - Intronic
1016932751 6:149426394-149426416 CACCTTCAGCACCATGAGGTTGG + Intergenic
1017872080 6:158494908-158494930 CACCTTTAGTGGCTTAAACTAGG + Intronic
1018095790 6:160386103-160386125 CACCTTGAGCACCTTGAGCACGG + Intronic
1023558107 7:41444371-41444393 TGCCTTTAGCAGTTTGAGATGGG + Intergenic
1024402833 7:48944875-48944897 CTCTTTTAACAGCTTGAGATAGG + Intergenic
1026824188 7:73571033-73571055 CAACTTGAGCAGCTCCAGCTAGG + Intronic
1030615627 7:111735135-111735157 CACCCCTAGCAGCTGGAGCCTGG - Exonic
1031645820 7:124223559-124223581 CACCTTTTGCTGATGGAGCTTGG - Intergenic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1036190237 8:6663371-6663393 CACCTTTAGCAACAAGAACTTGG - Intergenic
1040829223 8:51659353-51659375 CAGCTTCATCAGCTTGTGCTGGG - Intronic
1041738269 8:61133588-61133610 CACCTTGAGGGGCTTGAGGTTGG + Intronic
1044183718 8:89226349-89226371 CACCTTTTACAGCTTGTCCTTGG - Intergenic
1044282408 8:90371375-90371397 CACATCTAGCAGCCTGACCTAGG + Intergenic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1058626311 9:106936758-106936780 CACTTTTACCAGCGAGAGCTGGG + Intronic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1061496528 9:130977954-130977976 CAACTCTGGCAGCCTGAGCTGGG + Intergenic
1186374326 X:8981944-8981966 CATCTGTAGCAGCTAAAGCTCGG - Intergenic
1187562937 X:20419411-20419433 TGCCTTTAGCAGCAAGAGCTAGG + Intergenic
1189523035 X:41790236-41790258 CAACTTTAGCACCTGGAGATGGG + Intronic
1189905130 X:45750994-45751016 CACCTTTAGAAGCTTGTTTTAGG - Intergenic
1195845212 X:109220318-109220340 GACCTTTAACTGCTTCAGCTTGG + Intergenic
1198848622 X:140940959-140940981 CACCTTTATCAGCAATAGCTTGG - Intergenic