ID: 1087795465

View in Genome Browser
Species Human (GRCh38)
Location 11:102451928-102451950
Sequence GGCCGCCTCAACTACCGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087795462_1087795465 -10 Left 1087795462 11:102451915-102451937 CCGCCATGGGGGCGGCCGCCTCA 0: 1
1: 0
2: 1
3: 8
4: 119
Right 1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
1087795460_1087795465 -8 Left 1087795460 11:102451913-102451935 CCCCGCCATGGGGGCGGCCGCCT 0: 1
1: 0
2: 1
3: 18
4: 200
Right 1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
1087795461_1087795465 -9 Left 1087795461 11:102451914-102451936 CCCGCCATGGGGGCGGCCGCCTC 0: 1
1: 0
2: 5
3: 179
4: 5255
Right 1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 23
1087795450_1087795465 26 Left 1087795450 11:102451879-102451901 CCGGGTGTTTATGGCACACGAGG 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087795465 Original CRISPR GGCCGCCTCAACTACCGCGA GGG Intronic
915358100 1:155268728-155268750 GGCCACCTCATCTACCACGTCGG - Exonic
1067019507 10:42782564-42782586 CGCGGCCTCAACTTCCGCGGTGG - Intergenic
1067951189 10:50739720-50739742 CGCTGCCTCAACTCCCGCGGTGG - Intronic
1087795465 11:102451928-102451950 GGCCGCCTCAACTACCGCGAGGG + Intronic
1119383004 14:74240443-74240465 GGCCGCTTTAGCTGCCGCGATGG - Intronic
1126111121 15:45175325-45175347 GGCCCCCTCACCTTCCGCGGTGG + Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1133522640 16:6573988-6574010 GGCTGCCTCAACGCCCGCGGAGG - Intronic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1161434026 19:4251164-4251186 GGCCGTCTCACCTACCTTGAAGG - Exonic
937368856 2:121284519-121284541 GGCCGCCCCACTTCCCGCGATGG - Intronic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1171767942 20:29300534-29300556 GGCCGCCCCAGGTACCGCGCGGG - Intergenic
1172793401 20:37521330-37521352 GGCCGCCGCCACTGCCGCCATGG - Exonic
1181597612 22:23926804-23926826 GGCAGCCTCATCTACGGCGTTGG - Intergenic
961665252 3:128490191-128490213 GGCCACCTCCACTACCGCAGTGG - Intronic
1019051491 6:169186987-169187009 AGCCGCCTCAACCACCTCCACGG + Intergenic
1021604330 7:22395079-22395101 GGCCACCTCAGCTACAGAGATGG - Intergenic
1049224775 8:141444962-141444984 GGCCTCTTCGACCACCGCGAAGG - Intergenic
1049771266 8:144383119-144383141 GGGCGCCCCCACTACCGCGGTGG - Exonic
1057872520 9:98729009-98729031 GGCAGCCTCAGCTGCCTCGAGGG + Intergenic
1203771471 EBV:52028-52050 GGCCGCCTCAAAAACGGAGACGG + Intergenic