ID: 1087809069

View in Genome Browser
Species Human (GRCh38)
Location 11:102590623-102590645
Sequence CTGAACTAGCATGAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087809065_1087809069 19 Left 1087809065 11:102590581-102590603 CCAGAGACTTTTCTTCCCTTGGC 0: 1
1: 0
2: 1
3: 41
4: 292
Right 1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 138
1087809066_1087809069 4 Left 1087809066 11:102590596-102590618 CCCTTGGCACATTACTTACGTCA 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 138
1087809067_1087809069 3 Left 1087809067 11:102590597-102590619 CCTTGGCACATTACTTACGTCAC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG 0: 1
1: 0
2: 1
3: 8
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087809069 Original CRISPR CTGAACTAGCATGAGGAGCA AGG Intronic
902571062 1:17347436-17347458 CTGGAGCAGCAGGAGGAGCACGG - Intronic
902767127 1:18624717-18624739 CTGTACTGTCCTGAGGAGCAGGG - Intergenic
903959773 1:27049536-27049558 CTAAACCAGCATGAGAACCAAGG - Intergenic
904922472 1:34019795-34019817 CTGAACTGGCTTGAGGGACAGGG - Intronic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
911244170 1:95498595-95498617 CTGAACTGCAAAGAGGAGCATGG - Intergenic
913590974 1:120324432-120324454 CTGAACTAACATGAAAATCAGGG - Intergenic
913652396 1:120930671-120930693 CTGAACTAACATGAAAATCAGGG + Intergenic
914168712 1:145198398-145198420 CTGAACTAACATGAAAATCAGGG - Intergenic
914523834 1:148442357-148442379 CTGAACTAACATGAAAATCAGGG - Intergenic
914599841 1:149193510-149193532 CTGAACTAACATGAAAATCAGGG + Intergenic
914642572 1:149624783-149624805 CTGAACTAACATGAAAATCAGGG + Intergenic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
920975452 1:210781408-210781430 CTGAAATGGCATGAGGACAAAGG - Intronic
921147861 1:212376741-212376763 CTGGACTAGTCTGAGGAGCTAGG + Intronic
922535165 1:226374286-226374308 CTGAACTGGCTTGGGGAGCTTGG + Exonic
923535876 1:234851511-234851533 CTGAACTGGCATGATTGGCATGG + Intergenic
924078267 1:240363861-240363883 CTGAGCCAGCATGACCAGCATGG - Intronic
924093847 1:240530317-240530339 CTGGACTAGCATTACAAGCAAGG + Intronic
1062947424 10:1472261-1472283 CTGACCATGCATGAGGGGCAAGG + Intronic
1065133084 10:22642166-22642188 CCGAGCTAGGATGTGGAGCAAGG - Intronic
1068018324 10:51545932-51545954 CTGAACTAGCTTTAGCTGCATGG + Intronic
1068020612 10:51578751-51578773 CAGAGCTAGCATGAGTAACATGG - Intronic
1074049939 10:109872479-109872501 CTCAACCAGGCTGAGGAGCATGG - Intronic
1074095793 10:110311315-110311337 CTGAACAACCATGAGTGGCAGGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1076941424 10:133612550-133612572 CTGAGCTAGTATGATGATCAAGG - Intergenic
1079173016 11:18114058-18114080 CTAAACTAAGATGAGGAGCAGGG + Intronic
1081102995 11:39028550-39028572 CTGAAATAGAATGAGGTGTATGG + Intergenic
1083155181 11:60818463-60818485 CTGACCTGCCAGGAGGAGCAGGG + Intergenic
1084983787 11:72849506-72849528 CTGAGCTTCAATGAGGAGCAGGG + Intronic
1087444325 11:98228689-98228711 GTAAACTAGCATGAGGAGTGGGG + Intergenic
1087809069 11:102590623-102590645 CTGAACTAGCATGAGGAGCAAGG + Intronic
1087954856 11:104273268-104273290 CTGTAGCAGCATGAGCAGCAGGG + Intergenic
1088712885 11:112524343-112524365 CCGAACTAGCTTGAGCAGAAAGG + Intergenic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1092171120 12:6374695-6374717 GGGAACAAGCGTGAGGAGCAGGG - Exonic
1094855716 12:34401929-34401951 CTGCCCTCGCATGAGGCGCATGG + Intergenic
1096571111 12:52523869-52523891 CTGAACAAGCGTGAGGTGGAAGG - Intergenic
1097071798 12:56360471-56360493 CGAAACTAGCTTGAGGAGCCTGG + Intergenic
1097899533 12:64858903-64858925 CTCATCTAGCCTGAGGGGCAGGG + Intronic
1100194203 12:92225525-92225547 CTGAAGTATCCTGAGCAGCAGGG - Intergenic
1100341509 12:93683862-93683884 CTGAACTTACATGCAGAGCAAGG - Intronic
1103721582 12:122978286-122978308 AGGAAGTAACATGAGGAGCAGGG - Intronic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1110458078 13:75712250-75712272 CTGAAGTGGCAGGTGGAGCAGGG + Intronic
1113520733 13:110938737-110938759 CTGAACTGGCTTGGGGAGCATGG - Intergenic
1114867035 14:26608427-26608449 CTGGACTAGTATGTGAAGCAGGG + Intergenic
1120177818 14:81313927-81313949 CTGATCTAGCCTGAGGTTCAAGG + Intronic
1121418299 14:93794524-93794546 CTTCATTACCATGAGGAGCAAGG + Intergenic
1123939816 15:25211392-25211414 CTGCAATAGCATGAAGACCAGGG + Intergenic
1124376112 15:29129853-29129875 CTGAGGTAGCATGGGGTGCATGG - Intronic
1129112757 15:73347470-73347492 CAGCCCTAGCATCAGGAGCATGG - Intronic
1129891784 15:79076429-79076451 CTGAGAGGGCATGAGGAGCAGGG - Intronic
1131096112 15:89655257-89655279 CTGACCCGGCATGAGGAGCCCGG - Intronic
1131325130 15:91435959-91435981 CTGAAGTAGCATAAGGAGCATGG - Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1132761138 16:1509162-1509184 CTGAAGCACCAGGAGGAGCAGGG + Intronic
1135714255 16:24747529-24747551 CACAACTATCAAGAGGAGCAAGG - Intronic
1138371553 16:56530951-56530973 CTGAGCTAGGATGTGGAGCTGGG - Intergenic
1139914597 16:70420265-70420287 CTAAACTGGCCTGAGCAGCATGG + Intronic
1140720848 16:77770402-77770424 CTGTTCTAGGAAGAGGAGCAAGG + Intergenic
1143168026 17:4908377-4908399 CTCCTCCAGCATGAGGAGCAAGG - Intergenic
1145284767 17:21497221-21497243 TTTAACTAACATGAGAAGCAGGG - Intergenic
1145392756 17:22468542-22468564 TTTAACTAACATGAGAAGCAGGG + Intergenic
1146002613 17:29140281-29140303 AGGAAATAGCATGAGGAGCCTGG + Intronic
1146748515 17:35353891-35353913 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1146757054 17:35442118-35442140 CTGAACTTGCAGGAGAAGCCAGG - Exonic
1149585952 17:57786946-57786968 GTGAACTAGCATGAGAGGCTAGG - Intergenic
1153598682 18:6756657-6756679 GTGAAATACCATGAGGAGCAAGG + Intronic
1158838666 18:61359532-61359554 CTGAACAAGGGTGGGGAGCATGG + Intronic
1159913662 18:74169646-74169668 CTGAATCACCATGAGGAGCAGGG + Intergenic
1163449250 19:17365976-17365998 CTGATTCAGCATGAAGAGCAAGG + Exonic
1164965090 19:32476337-32476359 CTGAACTAAAATGAGGAAGATGG - Intronic
1166111130 19:40623669-40623691 CTGCAATAGCATGAGTAGCCCGG - Exonic
1166794386 19:45417560-45417582 GTGAAATTCCATGAGGAGCATGG + Intronic
1167084130 19:47297458-47297480 CTGAGCTGGCTTGAGGAACAGGG - Intronic
925257906 2:2505856-2505878 CTGAACTTGCATGGTTAGCAGGG + Intergenic
925540102 2:4957472-4957494 CACAGCTAGCATGAGAAGCAAGG - Intergenic
927786681 2:25979745-25979767 CTGAAACAGCATGAGGTCCATGG + Intronic
931497369 2:62823418-62823440 CTGAAGTAGCATTAGGACCCTGG + Intronic
932553170 2:72793571-72793593 CTGAACTAGCTGGAGGAGTCAGG + Intronic
934117525 2:88811163-88811185 CTGAACAAGTACCAGGAGCAAGG + Intergenic
934847762 2:97673261-97673283 CTGAAGAAGGATGTGGAGCAAGG - Intergenic
935662030 2:105475133-105475155 CTGAACCAGGAGGAAGAGCAGGG + Intergenic
936915013 2:117631292-117631314 CAGAACTTGCCTGAGGAGAATGG + Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938734687 2:134175597-134175619 CTGAACTAGCCGGAAGAGGAGGG - Intronic
940647308 2:156405133-156405155 CAGCTCTAGCATGAGGTGCATGG + Intergenic
941915581 2:170811367-170811389 CTGAACAAGCATAAGGCGCTGGG + Intergenic
942492580 2:176504818-176504840 CTGAGCTATCCAGAGGAGCAGGG + Intergenic
945268717 2:207917116-207917138 TTGAAGTAGAATGAGGAGAATGG + Intronic
947817674 2:233048919-233048941 GTGAGCTAGCCTGAGGAGCGTGG + Intergenic
948272276 2:236683756-236683778 CTGGGCAAGCATCAGGAGCAGGG - Intergenic
1173375446 20:42478391-42478413 CTGATGTAGAAAGAGGAGCAGGG - Intronic
1178230122 21:30773370-30773392 CAGGAGTAGCATGAGGAACATGG + Intergenic
1183175846 22:36224172-36224194 CTGAACTAGGAAGAGGAGAATGG + Intergenic
1184866066 22:47202450-47202472 CTGCACTTGCACGTGGAGCATGG - Intergenic
949766827 3:7535981-7536003 CTGAAACATCTTGAGGAGCAGGG - Intronic
950232891 3:11292135-11292157 ATGAAGTTGCATGAGGAGCATGG + Intronic
950314213 3:11986349-11986371 CTGAACTACCATGTGGTCCAAGG - Intergenic
954010674 3:47634550-47634572 CTGAAGTAGAATGAAGAACAGGG + Intronic
959112952 3:102143739-102143761 CAGAACTAGCCTGGGCAGCATGG - Intronic
960702716 3:120452485-120452507 CTGAACTTACATGGGGACCATGG - Intergenic
970224302 4:13841402-13841424 CTTTAGTAGAATGAGGAGCATGG - Intergenic
974667725 4:64986815-64986837 CTGAACTTGGATGAGGAAGAGGG - Intergenic
977069544 4:92367253-92367275 CTCAACTAACATGTGTAGCAAGG - Intronic
978236183 4:106463737-106463759 CTGAATTCACTTGAGGAGCAAGG + Intergenic
978862791 4:113470665-113470687 CTGACCTAACATGAGGCTCAGGG - Intronic
980459316 4:133085484-133085506 TTGAACTAGCATGAGGTGGTAGG + Intergenic
980511595 4:133797450-133797472 CTGAGCTAGCATCATGAGTAGGG - Intergenic
981179360 4:141720940-141720962 CTGAACTAGGATAAAGATCAAGG - Intronic
981598046 4:146449434-146449456 CTGAAGGAACAAGAGGAGCAGGG + Intronic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
982773584 4:159420323-159420345 GGGAACTTGCATGGGGAGCAGGG + Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
994316412 5:98338931-98338953 CTGAAGTACCCTGTGGAGCACGG + Intergenic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1009762703 6:68028364-68028386 CTTCCCTAGCCTGAGGAGCAAGG + Intergenic
1013657717 6:112262779-112262801 CAGAGCTTGCATGAGAAGCAAGG - Intergenic
1014365005 6:120528902-120528924 AGGAACTAGAAGGAGGAGCAGGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1016892063 6:149016690-149016712 CTGCATTAACAGGAGGAGCAGGG - Intronic
1017809789 6:157976656-157976678 GTGCACCAGCATGAGGACCACGG + Intergenic
1018853198 6:167655852-167655874 CTGAGCTAGAAGGAGGAGAAAGG + Intergenic
1020956072 7:14740969-14740991 CTCATCTAGAAAGAGGAGCAAGG - Intronic
1021205874 7:17780247-17780269 CTGAACAAGAATGATGAGAATGG - Intergenic
1022418022 7:30195007-30195029 CTAAACTAGCACAAAGAGCAGGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1032919347 7:136527871-136527893 CTGAGCCTGCATGAGGAGCGGGG + Intergenic
1036515417 8:9439253-9439275 CTGAACTATTATGAGGCACATGG - Intergenic
1038841046 8:31185221-31185243 CTGAACTTGCAAGAGGAACAAGG + Intergenic
1044736691 8:95286108-95286130 CTGAAAGACCATGTGGAGCAGGG + Intergenic
1048590667 8:135818083-135818105 ATGAGCTAACAGGAGGAGCAAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1051506700 9:17834902-17834924 CTGGACAAAAATGAGGAGCAGGG - Intergenic
1052647257 9:31253117-31253139 TTGAACTACCATGGGCAGCAAGG + Intergenic
1053008800 9:34621896-34621918 CTAAACTTGCATGAGTAACATGG - Intronic
1053026642 9:34734855-34734877 CTGAAATACCATCAAGAGCATGG + Intergenic
1054998390 9:71420168-71420190 CTGAGATATCATGAGGTGCATGG + Intronic
1060260364 9:122069284-122069306 CTGACCTAGCCTGAGGAGGTAGG - Intronic
1061043913 9:128154182-128154204 CTGAACTTGCACGGGGAGAAGGG - Intergenic
1061477935 9:130881449-130881471 CTGAAGGTGAATGAGGAGCAAGG + Intronic
1192800096 X:74457537-74457559 CTGATCTAGCATGAGGGGAAAGG - Intronic
1193905027 X:87231820-87231842 ATGAGCAAGGATGAGGAGCAAGG + Intergenic
1199503151 X:148531519-148531541 ATGAAGTAGAAGGAGGAGCATGG + Intronic