ID: 1087822668

View in Genome Browser
Species Human (GRCh38)
Location 11:102729685-102729707
Sequence CTGAAAATACAAAATAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087822663_1087822668 11 Left 1087822663 11:102729651-102729673 CCAGCCTGACCAACATGGAGGAA 0: 131
1: 18991
2: 37342
3: 136677
4: 175403
Right 1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG No data
1087822665_1087822668 2 Left 1087822665 11:102729660-102729682 CCAACATGGAGGAACCTCGTCTC No data
Right 1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG No data
1087822664_1087822668 7 Left 1087822664 11:102729655-102729677 CCTGACCAACATGGAGGAACCTC 0: 6
1: 879
2: 14951
3: 40173
4: 124521
Right 1087822668 11:102729685-102729707 CTGAAAATACAAAATAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087822668 Original CRISPR CTGAAAATACAAAATAAGCT GGG Intergenic
No off target data available for this crispr