ID: 1087824823

View in Genome Browser
Species Human (GRCh38)
Location 11:102753403-102753425
Sequence ATTTTGATAATGATGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 5, 3: 60, 4: 607}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087824823_1087824828 9 Left 1087824823 11:102753403-102753425 CCTTGTTTCATCATTATCAAAAT 0: 1
1: 0
2: 5
3: 60
4: 607
Right 1087824828 11:102753435-102753457 CTCCGATACCTGGTCCAGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 79
1087824823_1087824824 -1 Left 1087824823 11:102753403-102753425 CCTTGTTTCATCATTATCAAAAT 0: 1
1: 0
2: 5
3: 60
4: 607
Right 1087824824 11:102753425-102753447 TGAACATCTCCTCCGATACCTGG 0: 1
1: 0
2: 0
3: 7
4: 85
1087824823_1087824827 8 Left 1087824823 11:102753403-102753425 CCTTGTTTCATCATTATCAAAAT 0: 1
1: 0
2: 5
3: 60
4: 607
Right 1087824827 11:102753434-102753456 CCTCCGATACCTGGTCCAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 77
1087824823_1087824825 5 Left 1087824823 11:102753403-102753425 CCTTGTTTCATCATTATCAAAAT 0: 1
1: 0
2: 5
3: 60
4: 607
Right 1087824825 11:102753431-102753453 TCTCCTCCGATACCTGGTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087824823 Original CRISPR ATTTTGATAATGATGAAACA AGG (reversed) Intergenic
902550332 1:17215372-17215394 ATGATGATGATGATGAAAGAAGG - Intronic
902594248 1:17497280-17497302 ATTTTTAAAAAGAAGAAACACGG - Intergenic
904979457 1:34484763-34484785 ATTTGAATAATAATGAAACTAGG + Intergenic
905618256 1:39416634-39416656 ATTTTGCAGATGAGGAAACAAGG - Intronic
906764633 1:48417510-48417532 ATTTTAAAAATTATAAAACAGGG + Intronic
907381864 1:54097382-54097404 AATTTAAAAATGATGGAACAAGG + Exonic
907635315 1:56128663-56128685 AATTTGATTATGAAGAAAAAGGG - Intergenic
907729599 1:57053230-57053252 ATTTTCGTTTTGATGAAACATGG - Intronic
907883568 1:58573480-58573502 ATTTAACTAATGAGGAAACAGGG + Intergenic
907894827 1:58677835-58677857 ATTTTGGAAATGAGGAAGCAAGG + Intronic
908001199 1:59682130-59682152 ATTTTACAAATGAGGAAACAGGG + Intronic
908007682 1:59743495-59743517 ATTTTGAGAAAGAGGAAACTGGG + Intronic
908497702 1:64711398-64711420 GTTTTTAAAATGATGAAACCAGG + Intergenic
909188225 1:72517008-72517030 ACTTTGGTAATAATGAAATAAGG + Intergenic
909367749 1:74847638-74847660 ATTTTGCTAATGATGACATTAGG + Intergenic
909997117 1:82294486-82294508 ATCTTGAGTATGATGATACATGG - Intergenic
910376064 1:86572399-86572421 ATTTTGATAATGAGGTATTATGG + Intronic
911029995 1:93476939-93476961 ATTTTACTAATGATGAAACAAGG + Intronic
911356885 1:96833587-96833609 ATTTAGAGATTGATGAAAGAGGG - Intergenic
911429352 1:97764090-97764112 AAGTTGATAAAGAGGAAACAAGG + Intronic
911436945 1:97872339-97872361 ATTTTAATAATGGTTAAGCAGGG - Intronic
911671396 1:100612934-100612956 ATTTTTATAATGATTACACGGGG - Intergenic
911717323 1:101148089-101148111 ATATTTATAATCATGAAATATGG - Intergenic
911785553 1:101941997-101942019 ATTTTGTAAATGAGGAAGCAAGG + Intronic
912044313 1:105435576-105435598 AGTTTGCTAATGCTGAAGCAGGG + Intergenic
912045466 1:105448614-105448636 AATTTGATAATTTTGTAACAAGG - Intergenic
912506287 1:110158802-110158824 ATTTTGGAATTGATGAAATAAGG - Intronic
913139767 1:115929246-115929268 ATATTGATAAGGTTGAACCAAGG - Intergenic
914702533 1:150148283-150148305 ATTTGGAAAATGAGGAAACAGGG - Intergenic
914788227 1:150852779-150852801 ATTTTGATGATGATGGAGAAGGG - Exonic
915055064 1:153121659-153121681 TTTTTTTTAATTATGAAACAAGG - Intergenic
915550287 1:156628685-156628707 ATTTTGATAATGGTCAAGCCAGG - Intergenic
915956743 1:160226592-160226614 AATTAGATAATCATCAAACAAGG - Intronic
916062697 1:161111339-161111361 ATTTTATAAATGAGGAAACAAGG - Intronic
916152055 1:161803613-161803635 ATGTTGATAATGATGGAAGCTGG + Intronic
916338429 1:163699851-163699873 CTTTTGATAATACTGAAAGAAGG + Intergenic
916837904 1:168567593-168567615 ATTTTAATAAATATGAATCAGGG + Intergenic
916908045 1:169310740-169310762 ATTTTACTAATGATGAAACTAGG + Intronic
916968128 1:169975889-169975911 ATGTTGATAATGGTGCAACAGGG - Intronic
917076487 1:171211416-171211438 GTAGTGATAATGATGAAATAAGG - Intergenic
917406775 1:174715397-174715419 AATTGGATATTTATGAAACAAGG - Intronic
917483517 1:175433792-175433814 ATATTCAGAATGAAGAAACAGGG + Intronic
917571779 1:176273382-176273404 ATTTTAATGATGAAGAAAAATGG + Intergenic
917872975 1:179258181-179258203 TTTTAAATAATGATGCAACATGG + Intergenic
918268120 1:182867128-182867150 GTTTTGATAATGATAAAAACGGG - Intronic
918538075 1:185596543-185596565 ATTTTGCTAAAGCAGAAACATGG + Intergenic
918820306 1:189245771-189245793 ATTTTGATATAAATGAAGCAGGG - Intergenic
918835474 1:189459005-189459027 TTTTTGACATTGATGGAACAGGG - Intergenic
918883782 1:190163759-190163781 ATTTTGAAAATAGTTAAACAAGG + Intronic
919181875 1:194096054-194096076 ATTTTGAAAATGAGGAAATGTGG + Intergenic
919314656 1:195955524-195955546 ATTTTCATAATGATATAACTAGG - Intergenic
919352367 1:196474172-196474194 ATTTTTATCATAAAGAAACATGG + Intronic
920041106 1:203098028-203098050 ATTATTATTATTATGAAACAGGG + Intronic
920297608 1:204968547-204968569 TTTTGGATAATGAGGAAAGAAGG + Intronic
921452127 1:215321654-215321676 ATTTTGATATTGCTGACAAAGGG + Intergenic
922131931 1:222788534-222788556 ATTAGGAAAATGATGACACAAGG + Intergenic
923110737 1:230888047-230888069 ACTTGGAGAATGGTGAAACAAGG + Intergenic
924234523 1:241989621-241989643 ATTTGGAAAAAGATGAAACCTGG + Intergenic
1063749828 10:8930711-8930733 TATTGGAGAATGATGAAACAGGG + Intergenic
1064355734 10:14616190-14616212 ATTTTGATAAAGCTGAACTAAGG + Intronic
1064736621 10:18388061-18388083 ATTTTGGTAAGGATGAGAAATGG - Intronic
1066370078 10:34813170-34813192 ATTTTGTGCAGGATGAAACATGG + Intronic
1066984388 10:42452197-42452219 ATTTTGCTAATGAAGAAATGAGG - Intergenic
1068295153 10:55061614-55061636 ATTTTGGTAATTATGAATAAAGG - Intronic
1068380459 10:56247328-56247350 ATTTTGAGACTATTGAAACAAGG + Intergenic
1068613592 10:59087756-59087778 ACTTTGGTAATGATGAAAATTGG - Intergenic
1068679633 10:59805782-59805804 ATTTTTATAATGAGAAAAAAAGG - Intronic
1068798885 10:61116589-61116611 ATTTTCATAATGAGAAACCATGG + Intergenic
1068828956 10:61471076-61471098 ATTTTGATAATGTTGATATCAGG - Intergenic
1069199490 10:65594991-65595013 ATATTTATAATGAAGAAACCAGG + Intergenic
1069645129 10:69991073-69991095 ATTTTGGAAAAGATGAAATAAGG - Intergenic
1069770698 10:70897710-70897732 ATTTTGATAATCATGCTAGAAGG + Intergenic
1070271483 10:74960703-74960725 AATTTTCTAATGAGGAAACAGGG - Intronic
1071221868 10:83476701-83476723 ATTTTAAAGATGATGAAATATGG - Intergenic
1071859731 10:89659861-89659883 ATTTTGATAATTAGGTAGCATGG + Intergenic
1072369807 10:94754243-94754265 ATTGTTAAAATGATGAAAAAAGG + Intronic
1072771863 10:98147604-98147626 ATACTGAGAATGATGAAACTAGG - Intronic
1072940381 10:99758646-99758668 ATTTTCGTAATGTTGAATCAGGG + Intergenic
1073200884 10:101734437-101734459 ATCTTGATAAGATTGAAACAAGG + Intergenic
1073877033 10:107936803-107936825 ATTTTTATTATTATGAAAGAAGG - Intergenic
1074686809 10:115969478-115969500 ATTTTGCTAAAGCTGGAACAAGG - Intergenic
1075907077 10:126090823-126090845 GTTTTGATAAAGAATAAACAAGG + Intronic
1075966985 10:126621615-126621637 ATTATGATAATGATGACATATGG + Intronic
1076066080 10:127448780-127448802 TTTTTCATAATGGTGAGACATGG + Intronic
1079221829 11:18569641-18569663 ATTTTGAAAATGGTTTAACATGG + Intronic
1079613362 11:22460564-22460586 ATTTTGATATTCATCAAACATGG + Intergenic
1079807438 11:24951264-24951286 ATTTTTATAATCATTTAACAAGG - Intronic
1079951109 11:26805906-26805928 ATTTTCAAAATTATGTAACATGG + Intergenic
1080064293 11:27992338-27992360 ATTATGAACATGATGAAATAAGG + Intergenic
1080079716 11:28201825-28201847 AATTTGACAAAGATGGAACAAGG + Intronic
1080146849 11:28996098-28996120 ATTTTACTCATGAGGAAACATGG - Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1080370142 11:31628654-31628676 ACTTTTATAAAGATTAAACAGGG + Intronic
1080549694 11:33361870-33361892 ATAATGAAAGTGATGAAACAAGG - Intergenic
1080625289 11:34023670-34023692 TTTTTAAAAATGATCAAACAGGG + Intergenic
1080726843 11:34906521-34906543 ATTTCTATTATGATGCAACAAGG + Intronic
1080851012 11:36070187-36070209 ATTTTGATATTGGCCAAACAGGG + Intronic
1082203309 11:49400410-49400432 ATTTTAACAATGATAAAACTGGG + Intergenic
1082293384 11:50409739-50409761 GTTTTGATAATGATAAAAACAGG - Intergenic
1082626147 11:55488563-55488585 ATTGTGATAATGCTAGAACATGG - Intergenic
1082699829 11:56414373-56414395 ATTTTGAAGATGAGGAAACTAGG - Intergenic
1082848761 11:57746629-57746651 ATTTTGAGAATAAAGAAACAAGG - Intronic
1082908853 11:58346464-58346486 CTTTTGATTATGATAAAACTGGG - Intergenic
1083547462 11:63559508-63559530 AATTTGAAAATGATGAAACCAGG - Intronic
1086582978 11:88420768-88420790 ATATTGAATATGGTGAAACATGG - Intergenic
1086651727 11:89299679-89299701 ATTTTAACAATGATAAAACTGGG - Intergenic
1087571506 11:99932635-99932657 ATTTTGAAAATGAGGAATTATGG - Intronic
1087820169 11:102702769-102702791 ATTTTGATGAGGATGAAAACTGG - Exonic
1087821850 11:102721417-102721439 ATTTTGATGCCGAAGAAACATGG - Exonic
1087824823 11:102753403-102753425 ATTTTGATAATGATGAAACAAGG - Intergenic
1087827162 11:102778640-102778662 ACTTTGATGATGATGAAAAATGG - Exonic
1087828797 11:102796680-102796702 ATTTTGATGAAGATGAAAGGTGG - Exonic
1087833162 11:102842170-102842192 ACTTTGATGATGATGAACAATGG - Exonic
1087844259 11:102954172-102954194 ATTTTGATGATGATGAAACCTGG - Exonic
1088117447 11:106328492-106328514 ATTTTTATAATGAAAATACAAGG - Intergenic
1088731453 11:112687485-112687507 ATTTTATAAATGAGGAAACAAGG - Intergenic
1088785706 11:113179956-113179978 ATTTTGTTAATGTAGAAACTGGG + Intronic
1089099844 11:115953236-115953258 ATTATGATGATGAAGTAACAGGG + Intergenic
1089752806 11:120663296-120663318 ATCTTGCAAATGAGGAAACAGGG + Intronic
1091337398 11:134782697-134782719 ATTTTAATACTGATGGAAAATGG - Intergenic
1091551736 12:1540270-1540292 ATCTTAATATCGATGAAACATGG - Intronic
1091765297 12:3116412-3116434 GTTCTGATGAAGATGAAACACGG + Intronic
1093212026 12:16319319-16319341 ATTTTGATTATAAGGAAACGTGG + Intergenic
1093470823 12:19500536-19500558 ATTTTGCAAATGAGGAAACCAGG - Intronic
1093949140 12:25144535-25144557 CTTTTGATGGTGTTGAAACAGGG + Exonic
1094008180 12:25778369-25778391 ATTTTAAAACTGATGAAATATGG - Intergenic
1094104003 12:26789437-26789459 ATTCTCATAATGGTGAAAAACGG - Intronic
1094334814 12:29337605-29337627 ATTTTGATTGTGTTGAAAAAGGG + Exonic
1094457185 12:30649045-30649067 ATTTATATTATGATGAAAAATGG - Intronic
1095166088 12:38973750-38973772 ATAATTATAATGATGGAACATGG - Intergenic
1095662842 12:44757771-44757793 ATTTTTATAATAGTGAAACCTGG + Intronic
1095725221 12:45445059-45445081 ACGTTGAAAATGATGAAAGAAGG + Intergenic
1096024902 12:48351796-48351818 ATTGTTGTAATGATGAAATAAGG - Intergenic
1097643646 12:62210439-62210461 ATTTTGACAATGTTGAATGAAGG - Intronic
1098082643 12:66805711-66805733 AAATTGATAATGATGGAGCAGGG + Intergenic
1098179246 12:67828553-67828575 ATTTTGCTTATGATAAAACAAGG - Intergenic
1098632029 12:72735168-72735190 AGTTTGATACTCATGAAAAATGG - Intergenic
1099482094 12:83180628-83180650 ATTTTAAAAATGAGGAAACTGGG + Intergenic
1099806825 12:87530941-87530963 TTATTGATAATTTTGAAACAAGG - Intergenic
1099832521 12:87862995-87863017 ATTTTTAGAAATATGAAACATGG + Intergenic
1100048901 12:90420012-90420034 ATATTGATACTAATGATACAAGG + Intergenic
1100151942 12:91749343-91749365 ATATTGATAATGATTAAAATAGG - Intergenic
1100400533 12:94225423-94225445 ACTTTGAAAAAGATGACACAAGG + Intronic
1100818927 12:98412940-98412962 ATTCCAATAATGATGAAAAAAGG - Intergenic
1100987818 12:100221090-100221112 ATTTTGTAAATAAAGAAACAAGG + Intronic
1101324345 12:103701867-103701889 ATTTTAATATTGCTGTAACATGG + Intronic
1101368024 12:104094447-104094469 GTTTTTATAATGGTGAAATAAGG - Intronic
1101903189 12:108806790-108806812 ATTTTGATTCTGAGGAAAAAGGG - Intronic
1102170120 12:110835932-110835954 TTTTTCAAAAAGATGAAACAAGG + Intergenic
1103078164 12:118001621-118001643 ATTATGAGAATGAGAAAACAAGG - Intergenic
1103243980 12:119439492-119439514 ATATTGAAAATGATAAAAGAGGG - Intronic
1106044571 13:26126693-26126715 ATATTGATAATGCTGCATCATGG - Intergenic
1106408233 13:29492587-29492609 CTTTTGAAAAGGATAAAACAAGG - Intronic
1106604926 13:31219886-31219908 TTGATGATAATGATGAAAAAAGG + Intronic
1106897696 13:34322612-34322634 ATTTGCTTAATGATGAAAGAAGG - Intergenic
1107557031 13:41525323-41525345 ATATTGAAGATGATGAAAAAGGG - Intergenic
1107656969 13:42601519-42601541 ATCTTGAAAATGAAGAAACCCGG + Intronic
1107761006 13:43678666-43678688 ATTTTGCTGATGAGGAAACTTGG - Intronic
1108392152 13:49956937-49956959 ATTAAGATAATGAAGAACCATGG - Intergenic
1109575468 13:64250682-64250704 ATTTTGATAATGATCAAATCTGG + Intergenic
1110095846 13:71519396-71519418 TGATTGATGATGATGAAACATGG + Intronic
1110697064 13:78503469-78503491 ATTGTGATAATGATAATCCAGGG - Intergenic
1110752710 13:79133861-79133883 ATTTGGAAAATGAAGAAACTTGG + Intergenic
1110807739 13:79777261-79777283 ATTTTGATATTGAAATAACATGG + Intergenic
1110819220 13:79895123-79895145 GTTCTGATAAAGAAGAAACAAGG + Intergenic
1111310239 13:86474817-86474839 ATTATCATGATGATTAAACACGG + Intergenic
1111850300 13:93565031-93565053 ATTTTGACAATGTTGAAAAAGGG - Intronic
1111853975 13:93612694-93612716 ATATAGGTAATGAAGAAACATGG + Intronic
1112290362 13:98140683-98140705 ATGTTGATAATGTTGAGATAAGG + Intergenic
1112693489 13:101920626-101920648 ATTTTGATATTGAAAAAACATGG - Intronic
1113028141 13:105963945-105963967 ATTTTAATAATGAAGAAAGATGG - Intergenic
1114100129 14:19372745-19372767 ATAATAATAATGATGAAATATGG + Intergenic
1114140040 14:19899402-19899424 ATGTTGATAACTATGAAACCTGG - Intergenic
1114891004 14:26923048-26923070 ATTTTGATATTGCTGATAGAGGG + Intergenic
1115353528 14:32422869-32422891 ATTTTGAAATTGATGGAACCAGG - Intronic
1115397297 14:32922847-32922869 GTTATTATAAAGATGAAACAAGG - Intergenic
1115524836 14:34269473-34269495 ATTTTGACAATGATGACAACTGG - Intronic
1117615055 14:57526569-57526591 ATTCTGGTAATGATAAAGCAAGG - Intergenic
1118859694 14:69653039-69653061 ATTTTACAAATGAGGAAACAGGG + Intronic
1119098343 14:71855327-71855349 ATGTTGATAATGATGAATCTGGG + Intergenic
1120613267 14:86669117-86669139 ATTTTGATATTACTGAGACATGG + Intergenic
1123184937 14:106507541-106507563 ATTTGCATATTGATGAGACAGGG + Intergenic
1123483952 15:20667065-20667087 ATTTTTATAATGAAGAAACCTGG + Intergenic
1123679546 15:22750112-22750134 ATTTTGAGAATCATGAAGAATGG - Intergenic
1123829704 15:24122172-24122194 ATTTTGAGAAAGAAGAAAAAAGG - Intergenic
1123859770 15:24452764-24452786 ATTTTGAGAAAGAAGAAAAAAGG - Intergenic
1124331765 15:28824567-28824589 ATTTTGAGAATCATGAAGAATGG - Intergenic
1124345197 15:28917591-28917613 ATGTTAATAATGAGGAAACAGGG - Intronic
1124937247 15:34184871-34184893 GTTTTAATAAAAATGAAACATGG - Intronic
1125527778 15:40389027-40389049 ATTTCAAAAATGAGGAAACAAGG + Intronic
1125778502 15:42241685-42241707 ATTTTTAAAATGAAAAAACAAGG + Intronic
1126153506 15:45543945-45543967 ATCTTGATTATGATTGAACATGG + Intergenic
1126794533 15:52249487-52249509 AAATTGACAATGAGGAAACAGGG + Intronic
1126923763 15:53558500-53558522 ATTTCCATAAAGATGAAAGATGG - Intronic
1127272116 15:57411093-57411115 ATTTTGATATTAAGAAAACATGG - Intronic
1127525702 15:59790605-59790627 ATTTTTATTATTTTGAAACAGGG - Intergenic
1127704547 15:61534085-61534107 ATTTTAAAAATGATGCAATAAGG - Intergenic
1127707742 15:61563794-61563816 CTTTTGATAATTTTGAAATAAGG - Intergenic
1128962924 15:72027122-72027144 ATTTTAATGATAATGAAATAAGG - Intronic
1129144838 15:73637279-73637301 ATGATTATAATGATGAATCATGG - Intergenic
1130113058 15:80982064-80982086 ATATTGAAAATGACGAAAAAAGG - Exonic
1130215255 15:81962305-81962327 ATTTTGATAATTAAGTAACATGG - Intergenic
1131497521 15:92925976-92925998 TTTTTCATAAAGATGAGACAGGG + Intronic
1131526446 15:93156463-93156485 ATTGTCATAATGATGAAAGAAGG - Intergenic
1131706726 15:95004471-95004493 ATTATGATAGGGATTAAACAAGG + Intergenic
1131851040 15:96543296-96543318 ATTTTGTGAAAGATTAAACAAGG - Intergenic
1132067583 15:98744810-98744832 GGTTTGATAAGGATCAAACAAGG - Intronic
1133401010 16:5487036-5487058 ATTCTCAAAGTGATGAAACAGGG - Intergenic
1133518052 16:6528945-6528967 AAATTGATAATGTTCAAACATGG - Intronic
1133678570 16:8098989-8099011 ATTTTGATAAAGATGACCCGGGG - Intergenic
1134297295 16:12958294-12958316 TTGTTTATAATGATGAAAAATGG - Intronic
1134363554 16:13555343-13555365 TTTTTGATAATGAATAAAGATGG + Intergenic
1135667209 16:24346024-24346046 ATTTTACCAATGAGGAAACAGGG - Intronic
1136943551 16:34616402-34616424 CTTTTGATAGTTTTGAAACACGG - Intergenic
1136943767 16:34619985-34620007 ATTTTGGTAGTTTTGAAACACGG - Intergenic
1138990262 16:62382356-62382378 AGTTTGCTAATGATAAAAGATGG + Intergenic
1138990456 16:62385104-62385126 ATTTTTATAATTGTGAAACAGGG + Intergenic
1140387098 16:74550828-74550850 ATTTTGATAATGCTGAACAAGGG + Intronic
1140932720 16:79642545-79642567 TTTTTCAAAATGAAGAAACAGGG + Intergenic
1141719700 16:85749581-85749603 ATTTTAAAGATGAGGAAACAGGG - Intronic
1143679553 17:8466167-8466189 ATTTGGAAAATGATTAAAAAAGG + Intronic
1143943614 17:10569333-10569355 GTCTTGATATTGATGAAATATGG + Intergenic
1144456677 17:15424384-15424406 ATTTTGAAGATGATGAGACATGG - Intergenic
1145051846 17:19668610-19668632 ATTTATATAATAATGAAATAGGG - Intronic
1146025906 17:29320488-29320510 ATTTTGAAGATGCTGAAACAAGG - Intergenic
1146097772 17:29948611-29948633 ATTTTGACAAGTATGTAACAAGG - Intronic
1147442393 17:40455198-40455220 ATGTTAATAATGAGGAAACTGGG - Intronic
1147848230 17:43420482-43420504 ATTTTGAAAATGAGAAAACTGGG - Intergenic
1148002974 17:44400948-44400970 ATTTGGATAATGTTGAGGCAAGG + Exonic
1149003613 17:51781910-51781932 ATTTTGTAGATGAGGAAACAGGG + Intronic
1149415756 17:56458298-56458320 ATTTTGCAAGTGATGAAACTGGG - Intronic
1150483616 17:65529281-65529303 ATGTTGATGATGACGCAACATGG + Exonic
1150584859 17:66508306-66508328 GTTTTGAGAATGATAAACCAAGG + Intronic
1150862539 17:68816075-68816097 ATTGTGAAAATGATCAAAGATGG - Intergenic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1154179980 18:12128066-12128088 ATATTTATAATTATAAAACATGG - Intronic
1155753277 18:29456189-29456211 GTTTTAATCATGATTAAACAGGG + Intergenic
1156194918 18:34763766-34763788 ATTTTCATTATGATCAAGCATGG - Intronic
1156444921 18:37229315-37229337 ATTTTGAAAACTATGAAAAAAGG - Intronic
1156791528 18:40980561-40980583 ATTCTGAAAATGATCAAATAGGG + Intergenic
1157030417 18:43900128-43900150 ATTTTAGTAATTATAAAACATGG - Intergenic
1157385364 18:47255462-47255484 ATTTTGCAAATGAAGAAACAGGG - Intergenic
1157866685 18:51193770-51193792 CTTTTGATACTGATGAAAGTTGG - Intronic
1158145871 18:54311342-54311364 ATAATAATAATGAAGAAACATGG + Intronic
1158201996 18:54951469-54951491 ATTTTGCAGATGAAGAAACAAGG + Intronic
1158794016 18:60819337-60819359 CTTTTGATAATTATGTAACTTGG + Intergenic
1160252894 18:77219106-77219128 ATTGTGATAATGGTGAAGGATGG + Intergenic
1160319969 18:77881206-77881228 ATTTTTATAAAGATGAAAGTAGG + Intergenic
1160334318 18:78024267-78024289 ATTTTGGTAATCAAGAAAAATGG + Intergenic
1162436225 19:10660996-10661018 ATCTTGCTAATTATGAAAAACGG - Intronic
1163197817 19:15736342-15736364 ATTTTTAAAATTATGAAACGTGG - Intergenic
1163224110 19:15943473-15943495 ATTTTTAAAATTATGAAAGATGG - Intergenic
1167633615 19:50640317-50640339 ATTTTGCTGATGAGGAAACGGGG - Intronic
925722017 2:6838731-6838753 ATTTCTATCATGATGTAACAAGG - Intergenic
925729448 2:6907604-6907626 ATTTTGCTGATGAGGAAACTGGG - Intergenic
925735839 2:6962936-6962958 ATTTTGATAATTTTAAAAGATGG + Intronic
925773947 2:7313534-7313556 ATTTTGGTAATTATGAATAAAGG + Intergenic
925838407 2:7967399-7967421 ATTTTGATGATGATAAATTAAGG - Intergenic
925877151 2:8321630-8321652 ATTTTGCCAATGATGAAATGAGG - Intergenic
926972241 2:18478487-18478509 ATTTTGATAATCATTAAATGTGG + Intergenic
927438940 2:23096082-23096104 ATTTTGATATCTATAAAACAGGG - Intergenic
927607214 2:24497085-24497107 ATTTTATAAATGAGGAAACAAGG + Intronic
928118633 2:28565895-28565917 ATTTTGCAGATGAGGAAACAAGG + Intronic
928332564 2:30368819-30368841 ATTTTAACAATGAAGAAACCAGG - Intergenic
928468973 2:31554606-31554628 ATGTTGAGAATGATCACACAAGG + Intronic
928504994 2:31941911-31941933 ATTCTGATATTGATTAAAAACGG + Intronic
930269866 2:49243399-49243421 ATTTTAAAAATGAAGAAAAAAGG + Intergenic
930325471 2:49911313-49911335 ATTTTGTAGATGAGGAAACAGGG - Intergenic
930579054 2:53187625-53187647 ATTTCCAAAATGAGGAAACAAGG + Intergenic
930873556 2:56190269-56190291 AGTTTGGTAAGGATGAAACAGGG - Intronic
931017603 2:58002530-58002552 ATTTTGAGAATGAAGAAAAATGG + Intronic
931060149 2:58519219-58519241 ATTTTGTTAATTAGGAAAAAAGG - Intergenic
931081690 2:58780481-58780503 ATTTTGAACATTATGAATCAAGG + Intergenic
931961593 2:67488958-67488980 CTTTTGATGAAGATGAGACAAGG + Intergenic
932439515 2:71723781-71723803 ATTTTCAGAATGATGAAATGAGG + Intergenic
932724267 2:74164556-74164578 ATTTTTATAATCTTGAAGCAGGG + Intronic
932929672 2:76019542-76019564 ATTTTGCAAATGAGGAAACTGGG - Intergenic
932977227 2:76617826-76617848 AATTTAATAATGATATAACAAGG - Intergenic
933121457 2:78542566-78542588 ACTCTGATAATGACAAAACAAGG + Intergenic
933210605 2:79564091-79564113 ATTTTGGTAATGCTGAAAGTAGG - Intronic
933486465 2:82930730-82930752 AGTAAGATATTGATGAAACATGG - Intergenic
933548471 2:83743577-83743599 ACATTTATAATGATGAAAAATGG - Intergenic
933891891 2:86779434-86779456 ATTTTCATAATGACAAAATAAGG + Intergenic
934063777 2:88320895-88320917 ATTTTGTAGATGATGAAACTTGG + Intergenic
934138656 2:89022803-89022825 ATTGTGAGAAACATGAAACATGG - Intergenic
934230591 2:90177757-90177779 ATTGTGAGAAACATGAAACATGG + Intergenic
934864626 2:97795398-97795420 ATTTAGATAAAGAAGAAAGAAGG - Intronic
935404514 2:102694786-102694808 ATTTTGAAAAGTATGAAATATGG - Intronic
936598163 2:113869197-113869219 ATTTTAATAATGAAGAACCCAGG - Intergenic
936760567 2:115775638-115775660 ATTTTGAAAATGAAAAAATATGG + Intronic
937061009 2:118980520-118980542 ATTTTGATAATTCTGAAGCTGGG - Intronic
937786496 2:125905318-125905340 ATTTTTATATGTATGAAACATGG - Intergenic
938098454 2:128478794-128478816 ATTTGTATAATGAGAAAACAAGG + Intergenic
940044600 2:149395955-149395977 ATATTGTCAATGATCAAACAAGG - Intronic
940281622 2:151995003-151995025 AGTTTGATGCTGATCAAACAAGG + Intronic
940635294 2:156292022-156292044 ATTCTGATAAAGATTAAACATGG - Intergenic
942125448 2:172820332-172820354 ATTTTGAATATGCTCAAACATGG - Intronic
942504919 2:176631531-176631553 ATTATTAAAAAGATGAAACATGG - Intergenic
942590394 2:177538778-177538800 ATTTGTATATTGATGATACAAGG - Exonic
943529388 2:189060064-189060086 ATGATGATAATGATGAAGGAGGG - Intronic
943798866 2:192032779-192032801 ATTTTGCTGATGAGGAAACGGGG - Intronic
944090018 2:195896830-195896852 CTTTTCAGAATGATGAGACATGG + Intronic
944502560 2:200377179-200377201 ATTTTACTGATGAGGAAACACGG + Intronic
945046004 2:205782373-205782395 GTATTGATACTGATGATACAGGG + Intronic
945282057 2:208045357-208045379 ATTTTTATAATGAGAAAATATGG + Intergenic
945545810 2:211149928-211149950 ATATTGAAAATGATGATGCAGGG - Intergenic
945621230 2:212141324-212141346 ATTTTATTAATGAAGAAACTTGG + Intronic
946808661 2:223498613-223498635 ATTTTGCTAAGGATGAACCCTGG + Intergenic
947448466 2:230183001-230183023 ACTTTGATAATGAATAAAAAGGG + Intronic
1169911269 20:10649481-10649503 ATTTTGATTTTCATGAAACTTGG - Intronic
1169953111 20:11070086-11070108 ATATTGCTAATGAAAAAACAAGG - Intergenic
1170088603 20:12565562-12565584 ATTTTGTACATGAAGAAACAAGG - Intergenic
1170435349 20:16321462-16321484 ATTTTCACGATGATGAAACTAGG - Intronic
1170446659 20:16435086-16435108 ATATTAATAATAAAGAAACATGG - Intronic
1170493458 20:16901283-16901305 ATTTTTATAATGATGATGCCTGG - Intergenic
1171002722 20:21430886-21430908 TTATTGTTAATGATGAAAGAGGG + Intergenic
1171046760 20:21815670-21815692 AATTTGATAGTGACCAAACAAGG + Intergenic
1171168853 20:22997634-22997656 AATTTGATAATAGTGAAAAATGG + Intergenic
1171243330 20:23588570-23588592 ATTTTTATAGTGAAGAATCAGGG + Intergenic
1171973910 20:31581712-31581734 AGTTTGAGGATGAGGAAACAGGG - Intergenic
1172618041 20:36302278-36302300 AATTTGATAATGATTAAATCCGG - Intergenic
1172886318 20:38233510-38233532 ATTTTGCTGATGAGGAAACTGGG + Intronic
1173155386 20:40604250-40604272 ATGTTGATGATGATGTGACAGGG + Intergenic
1174075048 20:47929050-47929072 ATTATGATAAAAATGATACAAGG - Intergenic
1174733239 20:52938618-52938640 CTTTTGATAAAGGTGTAACATGG - Intergenic
1174955273 20:55091007-55091029 ATTTTACTAATGAAGAAACAGGG + Intergenic
1177199681 21:17940058-17940080 ATTTTAATAATTTTAAAACAAGG + Intronic
1177326981 21:19603066-19603088 ATCTTTATAATGATAAATCATGG + Intergenic
1177606511 21:23385596-23385618 ATTTTGCCTATGAAGAAACATGG + Intergenic
1177858458 21:26425580-26425602 ATTTTCCTATTTATGAAACAGGG + Intergenic
1177937917 21:27372727-27372749 ATTATGATAAAAATGAAAGAGGG + Intergenic
1178113114 21:29389399-29389421 AATGTGCTAATGATGTAACAAGG + Intronic
1178779306 21:35586262-35586284 ATTTTGATAATGATGCAGGAAGG - Intronic
1179040480 21:37798082-37798104 ATTATTAGAATGATAAAACAGGG - Intronic
1179331839 21:40410570-40410592 AGTTTGATAATGATGCATCTCGG - Intronic
1179728044 21:43351136-43351158 ATTTTGATAGTGAGGAAAAAAGG - Intergenic
1180566655 22:16673416-16673438 ATATTTATAATTATAAAACATGG + Intergenic
1181339297 22:22165557-22165579 ATTTTGAAAGTGAGGAAAGAGGG - Intergenic
1182904974 22:33927966-33927988 CTTGTGATCATGAGGAAACATGG - Intergenic
1184914235 22:47558198-47558220 ATATTGCTAATAATGACACATGG - Intergenic
950127154 3:10516796-10516818 ATTTTGCAGATGAGGAAACAAGG - Intronic
950223256 3:11212778-11212800 GTTTTGACTTTGATGAAACAGGG - Intronic
950469423 3:13175250-13175272 ATTTTACAAATGAGGAAACATGG - Intergenic
950899268 3:16482628-16482650 ATTTTACAAATGAGGAAACAAGG - Intronic
951101743 3:18696070-18696092 TTTTTGCTAATGTTGAAATAAGG - Intergenic
951779165 3:26343728-26343750 AAGTTGAGAATGAAGAAACATGG - Intergenic
951902592 3:27671503-27671525 GTTTTGGTAATGATTAAATATGG + Intergenic
951968193 3:28413220-28413242 AGGTTGATCATGATGAACCATGG + Exonic
953727620 3:45414152-45414174 TTTTTTATAATGCTGAAAAATGG + Intronic
955193347 3:56782681-56782703 TTTTTGTTAATGAGGGAACAGGG + Intronic
955438047 3:58925007-58925029 ATGTTCATAATGAGAAAACAAGG - Intronic
955455349 3:59114769-59114791 ATATTAAAATTGATGAAACATGG + Intergenic
955459323 3:59163402-59163424 ATTTTGAAGATGAAGAAACAGGG - Intergenic
956008589 3:64806439-64806461 ATGATGATGATGATGAAACATGG - Intergenic
956175383 3:66468361-66468383 ATTCTGTTAATGTTGAAAAATGG - Intronic
956267479 3:67413333-67413355 ATTTTCAGCATGATGAAAGATGG + Intronic
956638961 3:71396408-71396430 ATTTTGTAAATGAGGAAACTGGG + Intronic
956939775 3:74144511-74144533 TTTTTGATAATGATGAAGATTGG - Intergenic
957315960 3:78577217-78577239 ATTTTGATACTGATTACAAATGG + Intergenic
957403362 3:79745588-79745610 ATTTTGAAAATAAAGAAAAAAGG - Intronic
957562235 3:81837103-81837125 ATGTGTATAATGATGAAAAATGG - Intergenic
957615056 3:82516498-82516520 CTTCTGATAATGATGGAAAAGGG + Intergenic
957729682 3:84117605-84117627 ATTTTGATCTTGAGAAAACAAGG - Intergenic
958716156 3:97784104-97784126 TTTTTCATAATGATGAAAATTGG + Intronic
958833755 3:99119673-99119695 ATTTTGCAAATGAGGAAACATGG + Intergenic
958896090 3:99831142-99831164 TTGTTTATAATGATGAAAAATGG + Intronic
959278043 3:104302967-104302989 ATTTTGAAAGTGATGAAAGTGGG + Intergenic
959279954 3:104324997-104325019 ATTTACATTATGATGCAACAAGG + Intergenic
959371509 3:105532734-105532756 ATTTTGGCATTGATGAAACTGGG + Intronic
959557114 3:107733448-107733470 GTTTTGAAAATTAGGAAACATGG + Intronic
959557495 3:107738875-107738897 ATTTTGTAAATGAGGAAACTAGG + Intronic
959610533 3:108289619-108289641 AATTTTATAAGAATGAAACATGG - Intergenic
960823628 3:121759822-121759844 ATTTTGAAAATTATGAAAAGAGG - Intergenic
962027883 3:131567810-131567832 ATTTTGAAGATAATGAAACAAGG + Intronic
962406492 3:135105021-135105043 ATTTTGCTAATGAGGAAACTGGG - Intronic
962606827 3:137039130-137039152 ATTGTGAAAATGATAATACAAGG - Intergenic
962986349 3:140539752-140539774 ATTTTGCCAATGAGGAAACTGGG + Intronic
963071378 3:141308156-141308178 ACATAGATAATGAAGAAACAAGG - Intergenic
963298625 3:143574781-143574803 ATTTTGACAAGGATGACACTTGG + Intronic
963476702 3:145814279-145814301 ATTTTTAAAATGATTATACAGGG - Intergenic
963666409 3:148193302-148193324 ATTATATTAATGATGAAAAAGGG - Intergenic
964568064 3:158080078-158080100 AGTTTTCTAAAGATGAAACAGGG - Intergenic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
965792617 3:172405843-172405865 AGTTTGAGAATGATGCACCATGG + Intergenic
965998004 3:174910776-174910798 ATTTTAAAGATGAAGAAACAAGG - Intronic
966024495 3:175259340-175259362 ATTTTGATCATGATGAGACTAGG + Intronic
966035495 3:175408728-175408750 ATTTTGATAATGACAATACAAGG - Intronic
966103238 3:176302034-176302056 AGTATTGTAATGATGAAACAAGG - Intergenic
966149695 3:176853666-176853688 ATTTTAACAAAGATGATACAAGG + Intergenic
966400221 3:179540242-179540264 GTTTTCATAATGATGAAACTCGG - Intergenic
966622626 3:181982345-181982367 ATTTTGGAAATGAAGAAACTGGG + Intergenic
967276249 3:187778156-187778178 ATTTTGGAAATGAAGTAACAGGG - Intergenic
967447950 3:189588898-189588920 ATTTTGTAAATGTGGAAACAAGG + Intergenic
967873527 3:194251277-194251299 AATGGGATAATGAAGAAACATGG + Intergenic
967904637 3:194489760-194489782 GTTTTGAGAATGGTGAAAAAAGG + Intronic
969831761 4:9803296-9803318 ATTTTGATGGTGATGATATACGG + Intronic
970002492 4:11378350-11378372 ATTTTGACAATCATGAATAAGGG + Intergenic
970255306 4:14162667-14162689 ATTTTCATAGTCATTAAACAAGG - Intergenic
970745182 4:19285753-19285775 ATTAAGATAATGATTAACCAAGG + Intergenic
970951696 4:21764482-21764504 ATTTATATAAAAATGAAACAAGG + Intronic
970991942 4:22222881-22222903 ATATAGATAAAGATAAAACATGG + Intergenic
971292044 4:25352034-25352056 ACGTTCATAATGATGAACCAGGG - Intronic
971526923 4:27631191-27631213 ATTTTACTAATGAAGAAACTAGG + Intergenic
971544154 4:27863274-27863296 ATTTTGATAATGATACAACTTGG + Intergenic
971826053 4:31623881-31623903 ATTTTGAGAATGAGGAAAAAAGG - Intergenic
972072911 4:35044522-35044544 ATCATGATAATGATAAAATATGG + Intergenic
972102170 4:35433785-35433807 GTTTTTATATTAATGAAACAAGG - Intergenic
972768583 4:42174340-42174362 ATTTTGCTATTGATAAATCAAGG - Intergenic
973166566 4:47085114-47085136 ATTTTGGATATGAGGAAACAGGG - Intronic
973869092 4:55146690-55146712 ATTTTGCTAATGAAGAAACAGGG - Intergenic
975134358 4:70860109-70860131 AGTTTAAAAGTGATGAAACATGG - Intergenic
975251993 4:72191510-72191532 AGTTAGATAATGAAGAAACAGGG + Intergenic
975373416 4:73614112-73614134 ATTTGGCTTATGATGAAAGAGGG - Intronic
975972687 4:80060565-80060587 ATTTTATAAATGAAGAAACAAGG - Intronic
976338494 4:83918792-83918814 ATTTTGCTGGTGGTGAAACAGGG + Intergenic
976483889 4:85577695-85577717 ATTTTAATAAAGATAAAATAGGG + Intronic
976590699 4:86846822-86846844 ATTTTGCCAATGATGAGATAAGG + Intronic
977057808 4:92215449-92215471 ATTTTGGTAAGAATGAAAAAAGG + Intergenic
977282274 4:95055741-95055763 ATTTTGAAAATAATAAAAAAAGG - Intronic
977370741 4:96131585-96131607 ATTTTTATAATAATTAAAAAAGG - Intergenic
977890986 4:102310988-102311010 ATTTTAATAGTGAGGAAATATGG + Intronic
978709562 4:111762661-111762683 CATTGGATATTGATGAAACAGGG - Intergenic
978870138 4:113565780-113565802 CTTTTGGGAATGTTGAAACATGG + Intronic
979277886 4:118833683-118833705 ATTTTCATAATGAGTCAACAAGG - Exonic
979519289 4:121648152-121648174 ATTGCTATAATGATTAAACAGGG - Intergenic
979563887 4:122132357-122132379 AATTTAATAATGAAGAAAAATGG - Intergenic
979574549 4:122272851-122272873 ATCTTGAGAATGATTACACAAGG + Intronic
979852356 4:125588833-125588855 ATTTTGTCAATGAGGAAACTGGG + Intergenic
979929507 4:126612895-126612917 ATTTTAAAAATGATTAAAGATGG - Intergenic
980267234 4:130533019-130533041 ATTTAGAATTTGATGAAACACGG + Intergenic
980482955 4:133413237-133413259 ATTTTGATAATGCTGCAACTTGG + Intergenic
980535264 4:134111968-134111990 GGTTTGAGAATTATGAAACAAGG + Intergenic
980574826 4:134671879-134671901 ATTTTTATAAATATCAAACAAGG - Intergenic
980920408 4:139080031-139080053 ATTTTGCTATAGATGACACAAGG + Intronic
981463304 4:145036040-145036062 ATTTTAAAAATTAAGAAACAAGG + Intronic
981997263 4:150988491-150988513 ATGTTGATAATGATTAAAGCTGG + Intronic
982307757 4:153951670-153951692 ATTTTGATAATGATGACAATGGG - Intergenic
982626321 4:157771032-157771054 ATTTTTAAAAAAATGAAACATGG + Intergenic
982878578 4:160679493-160679515 ACTTTGTTAATGATGTAAGAAGG + Intergenic
982987172 4:162224679-162224701 ATTTTCAAAATGCTGAAAGAAGG + Intergenic
984105609 4:175541555-175541577 ATTGTCTTAATGAAGAAACATGG - Intergenic
984347300 4:178545915-178545937 ATATAGATAAGTATGAAACATGG + Intergenic
985067504 4:186137595-186137617 TTTTTTATAGTGATGAAAGAGGG + Intronic
985223733 4:187736556-187736578 ATATTGAAAATAAGGAAACAAGG + Intergenic
985344088 4:188984873-188984895 ATAATGATAATGATAAAATATGG - Intergenic
985806205 5:2045287-2045309 TTTTAGATAATCAAGAAACAGGG + Intergenic
986613284 5:9591000-9591022 AGTTTTATAATCATGACACATGG - Intergenic
986878901 5:12145627-12145649 AATTTCATAATTATGAAACATGG + Intergenic
987215107 5:15727670-15727692 AGTTTGATAATAATGAATCTTGG + Intronic
987329823 5:16846796-16846818 ATTTTGCTAATGTGTAAACAGGG + Intronic
987475697 5:18389866-18389888 ATTTTGATAGTAAGGAAAAAAGG - Intergenic
987622779 5:20357472-20357494 ATTGTTATTATGTTGAAACAAGG + Intronic
987769604 5:22283143-22283165 TGTTTGATAATAATGTAACATGG + Intronic
990464427 5:56058519-56058541 ATGTTACTAATGATGGAACACGG - Intergenic
990504911 5:56434436-56434458 ATTTTACCAATGAGGAAACAAGG - Intergenic
990644239 5:57825857-57825879 ATTTAGATAATGCAAAAACATGG - Intergenic
990687756 5:58326225-58326247 ATGTTGATATTTCTGAAACATGG - Intergenic
990908183 5:60825691-60825713 ATTTGGAAAATGATGAGACTGGG + Intronic
990924010 5:60998333-60998355 TTTTTGAAAATTATGAAATAAGG + Intronic
990985330 5:61636357-61636379 ATTGTAACAATGTTGAAACATGG + Intergenic
991081247 5:62602504-62602526 ATTTTGCAAATGAGGAAAGAAGG - Intronic
991505910 5:67323875-67323897 ATTCTGACAATAATGAGACATGG - Intergenic
991925460 5:71701161-71701183 ATTTTGCTAATGATTAAAAATGG + Intergenic
992194232 5:74324150-74324172 ATTTTGATGCTGGTGAAACCAGG - Intergenic
992229721 5:74652239-74652261 ATTTTGCTCATGAGGAAACAGGG + Intronic
993251899 5:85538001-85538023 ATTTTGATAATAATTGCACAAGG + Intergenic
993659711 5:90617960-90617982 ATTTTTATAAGGAGGAAACACGG - Intronic
993788497 5:92175544-92175566 ATTTTGACGATGATTAGACATGG - Intergenic
994269353 5:97758822-97758844 ATTTTGAAAAGGCTGAAAAAGGG - Intergenic
994377373 5:99030320-99030342 CTTTTTAAAAAGATGAAACAAGG - Intergenic
994424339 5:99564481-99564503 ATTTTTAAAAGGATCAAACAAGG + Intergenic
994885075 5:105549570-105549592 ATTTTCAAAATGAAGAAATACGG - Intergenic
995165020 5:109029776-109029798 AGTTTGATTATGATGAATCTTGG + Intronic
995403992 5:111773604-111773626 ATTTTGATTATAATGTACCAAGG - Intronic
995600712 5:113792248-113792270 ATTCTGATAATGCTACAACATGG + Intergenic
995715017 5:115073736-115073758 ATTTCTATTATGATGCAACAAGG - Intergenic
996946093 5:129069844-129069866 ATTTTAATATTGATGAAATTGGG + Intergenic
997019238 5:129977717-129977739 ATTTTGACCATGATAAAACTTGG - Intronic
997848273 5:137307934-137307956 ATTTCCATAATGACAAAACAAGG + Intronic
998659301 5:144218678-144218700 ATTTTGATAATCATTATAAAAGG - Intronic
998770182 5:145534598-145534620 ATTTTGTGAATGAGGAAAAAGGG - Intronic
998838391 5:146226758-146226780 ATTTTGAGAATTGTGAAAAATGG + Intronic
999063280 5:148657955-148657977 TTTCTGATTATGATGAAAGAAGG + Intronic
999237488 5:150107776-150107798 TTTTACATAATGAAGAAACAAGG - Intronic
999912244 5:156215658-156215680 ATTATCAAAATGATGAAAGATGG + Intronic
1000150938 5:158500329-158500351 ATTTTGCAAATGAAGAAACTGGG - Intergenic
1000605496 5:163323136-163323158 ATTTTGCTAATGAGCAAACAGGG - Intergenic
1000894216 5:166835801-166835823 ATTTTGCAAATGAGGCAACAAGG + Intergenic
1001073955 5:168610221-168610243 ATTTTGACGATGATGAAAGGAGG + Intergenic
1002484661 5:179526234-179526256 AATCTCAAAATGATGAAACACGG + Intergenic
1002518601 5:179777238-179777260 ATTTTTATAATGATAAAACAAGG - Exonic
1003375968 6:5578158-5578180 ATTTTGATAAGAATGAATAATGG + Intronic
1003740953 6:8938696-8938718 ACTCTGAAAATGAAGAAACAAGG + Intergenic
1004040969 6:11975243-11975265 ATTATTATAAAAATGAAACAAGG + Intergenic
1004119020 6:12801177-12801199 ATTTTGATAATAATGTAGAAGGG + Intronic
1004240522 6:13917168-13917190 ATTTTGAAAACGATAAAAGAGGG + Intergenic
1004673400 6:17818685-17818707 ATTTTAAAAATGAGGAAACGGGG + Intronic
1005096598 6:22123378-22123400 TTTTTGCTAATGAGGAAACTAGG + Intergenic
1005104136 6:22204969-22204991 ATTTTCATATTTATCAAACATGG - Intergenic
1005225329 6:23635895-23635917 ATTGTAATAATGATGAGAAAGGG + Intergenic
1005443024 6:25891849-25891871 ATTTTGATATTAATGAAGAAGGG + Intergenic
1005591581 6:27334348-27334370 TTTTGGATGATGATGGAACATGG + Intergenic
1005770971 6:29070905-29070927 AGTTGGATAATGATGTAAGAAGG - Intronic
1007484571 6:42171997-42172019 ATTTTAAGAATGAGGAAACTGGG + Intronic
1008135372 6:47770252-47770274 CTTTTACTAATGATGAAAAATGG + Intergenic
1008286370 6:49656990-49657012 ATTATTATAATTCTGAAACAAGG + Intergenic
1008354525 6:50535599-50535621 ATTTAGATAATGAAGAAAAATGG + Intergenic
1008416486 6:51246832-51246854 ATTTTACAAATGATGAAACTGGG + Intergenic
1008816756 6:55578189-55578211 GTTATGAAAATGTTGAAACATGG - Intronic
1009280338 6:61742673-61742695 CTTTTGTTACTGATGCAACATGG + Intronic
1009502526 6:64433250-64433272 ATTTTGTTATTGTTGAAATATGG - Intronic
1009939776 6:70277789-70277811 TTTTTGATAATGTTAAAAAATGG - Intronic
1010033630 6:71295601-71295623 ATTTTAACAATGAAGAAACTGGG - Intronic
1010140489 6:72608625-72608647 ATTTTGAAAATGAGAAAACTGGG + Intergenic
1010534435 6:77010595-77010617 ATCTTGATATTAATCAAACATGG + Intergenic
1011548201 6:88503340-88503362 GTTTTTATAATGAAGAACCAAGG - Intergenic
1012114702 6:95281411-95281433 ATTTTGTAAATGATGAAACGGGG - Intergenic
1012295040 6:97511886-97511908 TTTTTGTTTCTGATGAAACACGG + Intergenic
1012322396 6:97866232-97866254 ATTTTGACAATGATGACAATTGG + Intergenic
1012597778 6:101060085-101060107 ATTTAGCTGATGATAAAACATGG + Intergenic
1013707821 6:112859764-112859786 ATTTTGAAAATGGTTAAACTAGG + Intergenic
1014341987 6:120221782-120221804 ATATAGATCATGATGAACCATGG + Intergenic
1014354735 6:120392659-120392681 ATTTTAAAAATAAAGAAACAAGG + Intergenic
1015014560 6:128396230-128396252 ATTTTTATTATGATTAAAAATGG - Intronic
1015472608 6:133622748-133622770 ATATTAATAATGATGAAATGGGG - Intergenic
1016481078 6:144482564-144482586 AGTTTGATAAAAATGAAAGAGGG + Intronic
1016669807 6:146690903-146690925 ATTTTGTAAATAAAGAAACAGGG + Intronic
1016716042 6:147230360-147230382 ATTTTAATAATGAAGCAATATGG - Intronic
1016768050 6:147817113-147817135 AGTCTGATGATGATGAAAAAAGG - Intergenic
1017307595 6:152937207-152937229 ATTTTGGTAAGGATAAAAGAAGG - Intergenic
1017320440 6:153086206-153086228 ATATTGAGTATGATGAATCATGG - Intronic
1017437313 6:154428522-154428544 ATTATGTTAATAATGAGACATGG + Intronic
1017503888 6:155049632-155049654 ATTTTAACAATTATGAAACATGG - Intronic
1018286849 6:162249787-162249809 ATTTTCATCCAGATGAAACATGG - Intronic
1019582802 7:1775678-1775700 ATTTTGATAATGATGTGCCTGGG + Intergenic
1020834777 7:13135359-13135381 ATTTTGAGGATGATGAAAAGGGG + Intergenic
1020861392 7:13496281-13496303 ATTTTGATAAAAGTGAAAGAAGG + Intergenic
1021049952 7:15970873-15970895 ATTATTATAATGATAGAACATGG + Intergenic
1022255241 7:28649652-28649674 ATTGGGAGAATGATGAAAAAAGG - Intronic
1022295427 7:29046849-29046871 ATTTTAAAAATAATTAAACATGG - Intronic
1022418655 7:30199587-30199609 ATTTTCATAAAGGTGAAGCAGGG - Intergenic
1023246623 7:38211778-38211800 ATTTTCTTACTGATGAAAAAGGG - Intronic
1023516957 7:41010694-41010716 ATTTTGAAAATGTGTAAACATGG - Intergenic
1023995122 7:45155098-45155120 ATCATGATAATGGTGAATCAGGG + Intergenic
1024303132 7:47903135-47903157 ATTTTGCAAATGTTGCAACATGG + Intronic
1024611964 7:51073838-51073860 ATCTTGATAATGGTGACACTGGG + Intronic
1024761895 7:52608501-52608523 ATTTTACTACTTATGAAACAAGG + Intergenic
1024862887 7:53866182-53866204 ATATTGATAAAGATGACACATGG - Intergenic
1026367624 7:69665047-69665069 ATTTTGCAAATGGTAAAACAGGG + Intronic
1027121259 7:75523407-75523429 AATTTGCTAAAGGTGAAACAAGG + Intergenic
1027889677 7:83955463-83955485 ATTTAGATACTGATGAATAATGG - Intergenic
1027889966 7:83960424-83960446 ATTTAGATAATGCTTAAAGAAGG + Exonic
1027986601 7:85299447-85299469 ATTTTCATAAAGAAGAAAAATGG - Intergenic
1028866112 7:95715321-95715343 ATTTTACCAATGATGATACATGG + Intergenic
1029056459 7:97749716-97749738 ATTTTGAAAATGAACAAACTTGG + Intergenic
1029935208 7:104417355-104417377 ATTGGGAATATGATGAAACAGGG - Intronic
1031580068 7:123462867-123462889 ATTATGATTATGATGACAGAGGG + Intronic
1031663225 7:124453472-124453494 ATTTGGAAAATGATAATACATGG + Intergenic
1031698008 7:124884770-124884792 ATTATGATATTGATCAAGCAAGG + Intronic
1031955658 7:127939934-127939956 GTTTTAATACTGATGAGACAAGG + Intronic
1032147661 7:129398792-129398814 ATATAAATAATGATGATACAAGG + Intronic
1032933553 7:136702317-136702339 ATTTTATTAATGATGAATAAAGG - Intergenic
1032981846 7:137293076-137293098 ATTTTGATAAGAATGCAAAATGG - Intronic
1033915409 7:146318389-146318411 ATATTGACAATGAAGTAACATGG - Intronic
1034007962 7:147495465-147495487 GTTTTATTAATAATGAAACAGGG - Intronic
1035145806 7:156814845-156814867 ATTTTTATGATGTTGAGACAGGG - Intronic
1035888926 8:3323753-3323775 ATTTTAACAATGATGAAAGGTGG - Intronic
1035888959 8:3323896-3323918 ATTTTAACAATGATGAAAGGTGG - Intronic
1035888974 8:3323967-3323989 ATTTTAACAATGATGAAAGGTGG - Intronic
1035888990 8:3324039-3324061 ATTTTAACAATGATGAAAGGTGG - Intronic
1035889126 8:3324610-3324632 ATTTTAACAATGATGAAAGGTGG - Intronic
1036159375 8:6372210-6372232 ATTTTAAAAATGAAAAAACAAGG + Intergenic
1036573236 8:10000221-10000243 ATTTTGGAAATCATGAAACTAGG - Intergenic
1037019376 8:13950217-13950239 TTTTTTATAATGATTAAACACGG - Intergenic
1037072623 8:14670772-14670794 ATTTTAAAGATGATGAAACTGGG + Intronic
1037184932 8:16051163-16051185 ATTTGGAAAATGATCAAAGATGG + Intergenic
1037744000 8:21629033-21629055 CTTTTGAAAATGATGCCACAGGG + Intergenic
1038570079 8:28654252-28654274 TTTTTGAGAATTATTAAACAAGG + Intronic
1039165335 8:34673138-34673160 ATTTTATCAATGAGGAAACAAGG - Intergenic
1039251640 8:35671872-35671894 ATTTTGATAATGCTGTAAGCTGG + Intronic
1039332011 8:36547931-36547953 ACTTTACTAATGAGGAAACATGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1043025761 8:75066172-75066194 ATTTTTAGAATGATGAATGAAGG + Intergenic
1043219248 8:77637776-77637798 ATTGAGTTAATGATGAAATAAGG + Intergenic
1043386636 8:79755484-79755506 TTTTTGTTATGGATGAAACATGG - Intergenic
1043539196 8:81240255-81240277 ATTTTGTAAATGAAGAAATAAGG - Intergenic
1043687281 8:83102796-83102818 ATATTGATACTAAAGAAACAAGG - Intergenic
1043999486 8:86861939-86861961 ATTTTAAAAATGAGAAAACAGGG + Intergenic
1044500964 8:92956215-92956237 ATATTGATAATGCTGCAACATGG + Intronic
1044681476 8:94782833-94782855 CTTTTGTTAATGATAACACAAGG - Intronic
1044850087 8:96419303-96419325 AATTTGAAAATGAACAAACAGGG - Intergenic
1045300162 8:100903797-100903819 GTTTTGATACTGAAGAAACTAGG - Intergenic
1045625459 8:104042977-104042999 ATGTTGAAAATGATTAAAGACGG + Intronic
1045717826 8:105069231-105069253 ATTTTGATTCTGTTAAAACATGG + Intronic
1045763302 8:105636495-105636517 ATATTCATGATCATGAAACAAGG - Intronic
1045932208 8:107640383-107640405 ATTTTGATACTGATGGCACTTGG + Intergenic
1046041344 8:108909141-108909163 ATTTTGATATTGAACCAACATGG + Intergenic
1046345321 8:112917325-112917347 ATTTTGAAGATGAGGAAATAAGG + Intronic
1046427084 8:114068195-114068217 AATTTGATAATCATGAACCTTGG - Intergenic
1046433546 8:114158864-114158886 GTTTTGATAATAAAGAAACTAGG - Intergenic
1046868716 8:119180096-119180118 ATTTTTATATTGATTGAACAAGG + Intronic
1046931616 8:119846949-119846971 ATTTTAACAATGATGAAATTGGG - Intronic
1046984928 8:120376812-120376834 TTTTTGCAAATGTTGAAACATGG + Intergenic
1047119034 8:121879498-121879520 ATTTGGACTATGATGATACATGG + Intergenic
1047166389 8:122444061-122444083 ATTCTGATGCTGATGAATCATGG - Intergenic
1047194178 8:122706431-122706453 ATTTTGATGATGATGGAAGAAGG + Intergenic
1047477905 8:125252542-125252564 ATCTTAATACTGATGAAACAGGG - Intronic
1047523260 8:125611956-125611978 ATTTAGATGATGAGGAAAAATGG + Intergenic
1047721183 8:127641397-127641419 ACATTGATAATTATGAAAAAAGG + Intergenic
1048399423 8:134050437-134050459 ATGTTGATGATGATGTCACAGGG + Intergenic
1049071941 8:140362398-140362420 ATTTTGATAATGATTTAATCTGG + Intronic
1050633757 9:7587580-7587602 ACTTAGAGAATGATTAAACATGG - Intergenic
1050740935 9:8819970-8819992 ACTTTAAGAATGTTGAAACAAGG - Intronic
1050989362 9:12129058-12129080 ATTTTGATATGGATTAAATAAGG + Intergenic
1050994935 9:12205197-12205219 ATTTTGAATATGATGAAGCTGGG - Intergenic
1051010232 9:12403648-12403670 ATTTTGCCAATGAGGAATCATGG - Intergenic
1051290751 9:15543259-15543281 ATTATGATTATGATGATTCATGG - Intergenic
1051621442 9:19053811-19053833 ATATTGATAAAGATGACACATGG + Exonic
1055705394 9:78994967-78994989 ATTGCTATGATGATGAAACAAGG + Intergenic
1055793599 9:79949864-79949886 TTTTTGATACAGTTGAAACACGG + Intergenic
1055865008 9:80802672-80802694 ATTTTGATAATATTAAAAAAGGG - Intergenic
1056748855 9:89330039-89330061 ATTATGATGTTGATGAAAAAAGG + Intronic
1056909456 9:90685274-90685296 ATTTTAATAATGTGGAAACCAGG + Intergenic
1057731900 9:97616685-97616707 ATGTTGGGAAAGATGAAACAAGG + Intronic
1058394456 9:104534580-104534602 GTATGGATAATGATGAAAGAAGG + Intergenic
1058430294 9:104912594-104912616 AGTTCTATAGTGATGAAACAAGG - Intronic
1058552639 9:106131976-106131998 ATTTTGTAAATGAAGAAACTGGG + Intergenic
1058611326 9:106779351-106779373 ATTTTATAAATGATAAAACAGGG + Intergenic
1058842531 9:108923916-108923938 ATTCTGATTCTGATGAAGCAGGG + Intronic
1059055896 9:110979033-110979055 CTATAGATAATGATGATACATGG + Intronic
1059306057 9:113354103-113354125 TTTTTGATAATGATGAGATCTGG + Intronic
1059743367 9:117177281-117177303 ATGGTGATAATAATAAAACAAGG - Intronic
1185916861 X:4045242-4045264 ATATTGAAAATGATGTAAGATGG - Intergenic
1186126804 X:6423043-6423065 ATTTTAATAGTGATGAAAAGTGG + Intergenic
1186346466 X:8698227-8698249 ATTTTGCAAATGATTAATCAAGG - Intronic
1186699989 X:12080276-12080298 ATTTTGAAAATAATGACACCAGG - Intergenic
1186754217 X:12653114-12653136 ATTTTACTGATGAGGAAACAAGG - Intronic
1187182252 X:16954258-16954280 ATTTTTAAAAAGATGAAAAATGG - Intronic
1187668855 X:21648163-21648185 ATTTTAATTAAAATGAAACATGG - Intronic
1188172325 X:26942951-26942973 ACTTTCATAATGAAGAAAGAAGG + Intergenic
1188673856 X:32914144-32914166 ATTTTGATAATGATGCTTGATGG - Intronic
1189630717 X:42949859-42949881 ATTTTTCTAAAGATAAAACACGG + Intergenic
1191646540 X:63487567-63487589 AGTTTGATAAGGATGATAAAGGG - Intergenic
1192932400 X:75821425-75821447 ACTTTTATAAAGATTAAACAAGG - Intergenic
1193038274 X:76977213-76977235 TTTATGATAATGATGATACCTGG - Intergenic
1193248383 X:79258437-79258459 ATATTGATAATCATGAACTATGG - Intergenic
1193509854 X:82385352-82385374 ATTTTTTTAATGATGAAACATGG - Intergenic
1193928207 X:87517516-87517538 ACTTTGATACTGAAGAAGCAGGG + Intergenic
1194425271 X:93729730-93729752 CTTTTGAAAATGCTGAAATAAGG - Intergenic
1194737140 X:97525827-97525849 TTTTTGATACTGATGACACAGGG + Intronic
1194852747 X:98889615-98889637 ATTTTCATGATAATGAAAGATGG + Intergenic
1195022986 X:100848116-100848138 ATCTTGAAAATGATGAAAAGAGG - Intronic
1195490761 X:105466866-105466888 TTTTTGTTGATGAGGAAACAAGG + Intronic
1195777701 X:108425957-108425979 CTGTTGATAATGAAGAAAAATGG - Intronic
1196528453 X:116754842-116754864 ATTTTAAAAATGATTAACCATGG + Intergenic
1196698709 X:118642550-118642572 CTTTTGATAATGGGGAAACTGGG + Intronic
1196959905 X:120990281-120990303 ATTTGGATGATGATGACACAAGG + Intergenic
1197985678 X:132264514-132264536 ATTGTGATAAAGATGAAAATAGG - Intergenic
1197998071 X:132401942-132401964 ATTATGAAAATGATGTAAAAAGG + Intronic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1199735576 X:150683141-150683163 ATGTTGATAATAAGGAAACTGGG + Intergenic
1199966960 X:152828609-152828631 TCTTTGATGATGATGAAACTGGG - Exonic
1200968842 Y:9128131-9128153 ATTTTCATCATGATGCAACAAGG - Intergenic
1200972536 Y:9169307-9169329 ATTTTGTTAACGCTGAAAAAGGG + Intergenic
1201708915 Y:16967656-16967678 ATTTTAAAAATGAAGAGACATGG - Intergenic
1202072280 Y:21004641-21004663 ATTTTGGTAATGAACAAAAAAGG + Intergenic
1202138484 Y:21694944-21694966 ATTTTGTTAACGCTGAAAAAGGG - Intergenic
1202141977 Y:21734370-21734392 ATTTTCATCATAATGCAACAAGG + Intergenic
1202144888 Y:21769432-21769454 ATTTTCATCATAATGCAACAAGG - Intergenic
1202160473 Y:21929510-21929532 AATATTAAAATGATGAAACAGGG + Intergenic
1202230883 Y:22656865-22656887 AATATTAAAATGATGAAACAGGG - Intergenic
1202312275 Y:23539300-23539322 AATATTAAAATGATGAAACAGGG + Intergenic
1202558528 Y:26131294-26131316 AATATTAAAATGATGAAACAGGG - Intergenic