ID: 1087828993

View in Genome Browser
Species Human (GRCh38)
Location 11:102798673-102798695
Sequence TGCTATCGCAATAGGGTACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087828993_1087829002 19 Left 1087828993 11:102798673-102798695 CCTGGTACCCTATTGCGATAGCA No data
Right 1087829002 11:102798715-102798737 TTACTCAGAGCCAGGCATGGTGG No data
1087828993_1087829001 16 Left 1087828993 11:102798673-102798695 CCTGGTACCCTATTGCGATAGCA No data
Right 1087829001 11:102798712-102798734 TCTTTACTCAGAGCCAGGCATGG No data
1087828993_1087829000 11 Left 1087828993 11:102798673-102798695 CCTGGTACCCTATTGCGATAGCA No data
Right 1087829000 11:102798707-102798729 CTTAATCTTTACTCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087828993 Original CRISPR TGCTATCGCAATAGGGTACC AGG (reversed) Intergenic
No off target data available for this crispr