ID: 1087832291

View in Genome Browser
Species Human (GRCh38)
Location 11:102832247-102832269
Sequence CACATTAACCATTAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087832291 Original CRISPR CACATTAACCATTAGGAGCT GGG (reversed) Intergenic
901907730 1:12428781-12428803 CACATCACCAATTAGGTGCTGGG + Intronic
902435467 1:16395758-16395780 AACATTAACCAATAGGATTTTGG + Exonic
907271732 1:53295307-53295329 CAGAGTGACCATTAGGGGCTGGG + Intronic
909322049 1:74301934-74301956 CACATTTACCAATAGGCACTTGG - Intronic
909666906 1:78144314-78144336 CACCTTAACCAGAAGAAGCTTGG - Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
915167537 1:153956802-153956824 GAAATTAACCAATAGGAGCAAGG + Intronic
917770086 1:178268172-178268194 CAAATTAAAAATTAGCAGCTGGG + Intronic
917990562 1:180373069-180373091 AACATGATCCATGAGGAGCTCGG - Intronic
918036427 1:180877492-180877514 CACAGTATACAGTAGGAGCTGGG - Intronic
1066076186 10:31879834-31879856 CACTATAACCATTAAGAACTTGG - Intronic
1066236509 10:33490138-33490160 CACCCTGACCATTAGGAGCCAGG - Intergenic
1068919998 10:62473430-62473452 CAGATTAACAAACAGGAGCTAGG - Intronic
1069545109 10:69322063-69322085 CGGTTTAGCCATTAGGAGCTTGG + Intronic
1072894152 10:99351234-99351256 CACATTACCTATTAGGCTCTTGG - Intronic
1073086119 10:100890283-100890305 CAAAGGAACCATTAGGAACTCGG + Intergenic
1075135121 10:119777686-119777708 AACATTACCCTTTAGGTGCTTGG - Intronic
1080730489 11:34946773-34946795 CAGATTCACTATTTGGAGCTAGG - Intronic
1086224341 11:84489577-84489599 GACATAAATTATTAGGAGCTAGG - Intronic
1087832291 11:102832247-102832269 CACATTAACCATTAGGAGCTGGG - Intergenic
1093942693 12:25071901-25071923 CCCATTAAGAAATAGGAGCTGGG + Intronic
1101484151 12:105134707-105134729 CACATTAACTATAAGGAGCCAGG - Intronic
1113160432 13:107374289-107374311 AACATTCACCATCAGGAGCAGGG + Intronic
1115699592 14:35938004-35938026 AACATTAACCATTTGGGGTTGGG + Intergenic
1120561249 14:85995747-85995769 CTCATGTGCCATTAGGAGCTAGG - Intergenic
1131291963 15:91114286-91114308 CACCTTAACCTTGAGGTGCTGGG + Intronic
1137044933 16:35645988-35646010 TACGTAAACCATTAGCAGCTTGG + Intergenic
1138686597 16:58731859-58731881 CACTTTTACCATTTGGAGCTAGG + Intronic
1155190359 18:23423930-23423952 CACGTCAATCATAAGGAGCTGGG + Intronic
925558337 2:5157570-5157592 CATATTTATCATTAGGAGCAAGG + Intergenic
926636226 2:15182476-15182498 CACATTGACTTTTAGAAGCTGGG + Intronic
931371767 2:61669696-61669718 GAGATTAACTATTAGTAGCTGGG + Intergenic
932388428 2:71360792-71360814 AACATTAACTATTAAGAGCAAGG - Intronic
941046766 2:160684737-160684759 CACATGAACAACTAGAAGCTTGG + Intergenic
944412373 2:199457480-199457502 GACCTTAAACATTAGGACCTGGG - Exonic
946496696 2:220202633-220202655 CAGATGAACCATGAGGAGCATGG - Intergenic
1169322847 20:4648610-4648632 CACATTACCCCTGAGTAGCTGGG - Intergenic
1169673233 20:8127802-8127824 CATATTAACCCCTAGGAGCCGGG - Intergenic
1169817493 20:9673197-9673219 CACATTAAGGATTAGGTGCCAGG - Intronic
1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG + Intergenic
1173065062 20:39702897-39702919 CACATTAACCTTCAGCAGCATGG + Intergenic
1177495370 21:21883247-21883269 CACATGAACAATTAGAGGCTTGG - Intergenic
1178450505 21:32694714-32694736 CATATTTGCCATTAAGAGCTGGG + Intronic
1180676991 22:17593529-17593551 CACAATAACCATCTGTAGCTAGG - Intronic
1181472118 22:23146801-23146823 CAGATTTACCTTGAGGAGCTGGG + Intronic
951685245 3:25336734-25336756 CACATTAACCTTTAGGTAATTGG - Intronic
955404334 3:58616399-58616421 CACATTCACAGGTAGGAGCTAGG - Intronic
958898688 3:99860356-99860378 CCCATTAATTATAAGGAGCTTGG + Intronic
967232455 3:187353099-187353121 CACATGACCCAGTAGGAGATGGG + Intergenic
968704576 4:2072003-2072025 CGCATTAACCCTTTGGGGCTGGG - Exonic
982753881 4:159195580-159195602 CACATTAGGCAGTGGGAGCTTGG - Intronic
984676601 4:182555956-182555978 TGCATTAAGCATTAGGACCTGGG - Intronic
985913793 5:2902739-2902761 CACATTGACCATAAAGAGCCAGG + Intergenic
986070940 5:4282034-4282056 CAAATTATCCATTAGTAGCCAGG + Intergenic
986956805 5:13160488-13160510 CACATAAATTACTAGGAGCTGGG - Intergenic
992551986 5:77867933-77867955 CATATTCACCATTAGGTGCCAGG - Intronic
994639901 5:102394825-102394847 GACAGTAACCTTTAGGAGATGGG + Intronic
995360239 5:111288927-111288949 GACTTTAACCAAAAGGAGCTAGG - Intronic
997009053 5:129855375-129855397 CATATTAAGCATCAGGAGGTAGG - Intergenic
998507537 5:142684141-142684163 CACATAAACTATTAGGATCTTGG - Intronic
1000043826 5:157505175-157505197 CACATTACCCATGAGGAACAGGG - Intronic
1010450629 6:75998357-75998379 CACATGGAACATTAGCAGCTTGG + Intronic
1013646489 6:112146624-112146646 GTCATTAAGCATTAGTAGCTGGG + Intronic
1022564133 7:31380237-31380259 CTCTTTAACCACTTGGAGCTGGG + Intergenic
1027507276 7:79032546-79032568 CACATTACCCATTATGAGAGTGG + Intronic
1027762569 7:82298717-82298739 CTCATTAGACATTTGGAGCTGGG - Intronic
1030847554 7:114439703-114439725 CACAAAAAAAATTAGGAGCTAGG - Intronic
1035652161 8:1275421-1275443 CACATTTACCATTAAGGCCTTGG + Intergenic
1036192107 8:6679649-6679671 CGCATTAACCAGAAGGAACTTGG - Intergenic
1188474143 X:30572133-30572155 CACATTAATCATTAACAGATAGG + Intronic
1196042714 X:111222853-111222875 CATATTAACAATGAGGAGCCAGG + Intronic
1196711061 X:118763350-118763372 CACAATAACCCTAAGGATCTAGG + Intronic
1201310787 Y:12596755-12596777 CTCATCAACCATCAGCAGCTAGG + Intergenic
1201542468 Y:15121429-15121451 AACATTATCCATCAGGAGTTGGG - Intergenic