ID: 1087832831

View in Genome Browser
Species Human (GRCh38)
Location 11:102838219-102838241
Sequence GTCCACGAGGGAAAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087832828_1087832831 -9 Left 1087832828 11:102838205-102838227 CCAATGGGTCTAAAGTCCACGAG 0: 1
1: 0
2: 0
3: 0
4: 48
Right 1087832831 11:102838219-102838241 GTCCACGAGGGAAAGCTGCATGG 0: 1
1: 0
2: 1
3: 7
4: 113
1087832827_1087832831 -8 Left 1087832827 11:102838204-102838226 CCCAATGGGTCTAAAGTCCACGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1087832831 11:102838219-102838241 GTCCACGAGGGAAAGCTGCATGG 0: 1
1: 0
2: 1
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087832831 Original CRISPR GTCCACGAGGGAAAGCTGCA TGG Intronic
900993703 1:6109238-6109260 GTACACCAGGGAGGGCTGCAGGG + Intronic
904132199 1:28283243-28283265 GTCCACTAGGGGAGGCTGCCTGG - Intergenic
906087059 1:43144941-43144963 GTCCACCAGGCCAAGCTGCTGGG - Intergenic
913077549 1:115353793-115353815 TTCCACCATGGAAAGCTGCTGGG - Intergenic
918460675 1:184773535-184773557 GCCCAAAAGGGAAAACTGCAAGG - Intergenic
919880544 1:201897946-201897968 GCCCACGGGGCAAAGCTGCTGGG - Exonic
921685325 1:218083078-218083100 CTCCCCAAGGGAAAGCTGCCTGG + Intergenic
921765465 1:218967634-218967656 GTGCAGGAGCAAAAGCTGCAAGG + Intergenic
923836282 1:237614736-237614758 GTGGACGATGCAAAGCTGCAAGG + Exonic
1064027950 10:11863984-11864006 GTCCACATGAGAAAGCTGCAGGG - Intronic
1064598864 10:16973221-16973243 GGCCACGAGGGGAGGCTGCAAGG - Intronic
1065480974 10:26193540-26193562 GACCAGCAGAGAAAGCTGCAAGG - Intronic
1067937036 10:50622215-50622237 GTCCACGGGCGAAGGCTGCGGGG - Intronic
1069733356 10:70634032-70634054 GTCCACATGGGAAAGATGCCAGG + Intergenic
1070114742 10:73517424-73517446 GCCCCAGAGGGTAAGCTGCAAGG - Exonic
1072409433 10:95186208-95186230 ATCCACTATGGAAAACTGCATGG + Intergenic
1072828028 10:98628270-98628292 GTCCAGGAAGGAAATCAGCATGG + Intronic
1072930777 10:99659803-99659825 GCCCACGAGACAAACCTGCACGG - Intronic
1073457801 10:103648060-103648082 ATCCACGCAGGAAAGATGCATGG + Intronic
1075557261 10:123442633-123442655 GTCCACCTGAGACAGCTGCAGGG - Intergenic
1076304964 10:129459644-129459666 TTTCACGAAGGAAAGTTGCATGG - Intergenic
1078917099 11:15788519-15788541 GTCCTCAACTGAAAGCTGCAAGG + Intergenic
1079467096 11:20741294-20741316 GTCTAGGAGGGAAAGCTAAATGG - Intronic
1080051615 11:27864396-27864418 CTCCAAAAGGGAAAGCTGAAAGG - Intergenic
1084819412 11:71674351-71674373 ATACACTATGGAAAGCTGCAGGG - Intergenic
1087832831 11:102838219-102838241 GTCCACGAGGGAAAGCTGCATGG + Intronic
1089096066 11:115921056-115921078 GGCCCCGAGGGATAGCTGGAAGG + Intergenic
1089283599 11:117391618-117391640 GTCTCTGAGGGACAGCTGCAAGG + Intronic
1097138152 12:56876652-56876674 GTCCACGAAGGAAGGCTGCTTGG - Intergenic
1100454113 12:94735128-94735150 GTCCAGGAGGGTAGGCTGTATGG - Intergenic
1100949742 12:99833567-99833589 CTCCACTAGAAAAAGCTGCAAGG + Intronic
1106381657 13:29245333-29245355 TTCCACCAGAGAAATCTGCAGGG + Intronic
1107388813 13:39942265-39942287 CTCCACAGGGGGAAGCTGCATGG - Intergenic
1111659618 13:91192992-91193014 GTGCAAGAGTGCAAGCTGCAAGG - Intergenic
1112205695 13:97321322-97321344 GTCCAGGAGGGGAAGATGCTGGG + Intronic
1112205899 13:97322962-97322984 GTCCAGGAGGGGAAGATGCTGGG + Intronic
1113967356 13:114161580-114161602 GTCCACCAGGGAAAGCTTCAGGG + Intergenic
1117771636 14:59139565-59139587 GTCCCTGAGGGAATGCTACAAGG - Intergenic
1118615393 14:67571672-67571694 GACCAGGAGTGCAAGCTGCAGGG + Intronic
1119649607 14:76374406-76374428 GGCCCAGAGGGAAAGCAGCAGGG + Intronic
1121016730 14:90553453-90553475 GCCCATGAGGGACAGCAGCAGGG - Intronic
1122886543 14:104712919-104712941 GTCCTCCAGGGACAGCTGCTGGG - Exonic
1133287680 16:4698161-4698183 GCCCATGAGGGCCAGCTGCAAGG - Intronic
1134539870 16:15055837-15055859 GGGCCCGAGGGGAAGCTGCAGGG - Intronic
1136153862 16:28369228-28369250 ATCCACTACGGAAAACTGCATGG + Intergenic
1136209229 16:28746036-28746058 ATCCACTATGGAAAACTGCATGG - Intergenic
1138007057 16:53347527-53347549 GTCCACAAGAGAAAGCAGGAAGG - Intergenic
1138456639 16:57124952-57124974 GTCCTTGAGGGACCGCTGCAGGG - Intronic
1153791893 18:8586483-8586505 GTCCAAGAGGGCCAGCTGGAGGG + Intergenic
1157478238 18:48036831-48036853 GTCCCCGTGGAAAGGCTGCAGGG + Intronic
1158781430 18:60656887-60656909 GTCCCTGAGGGAAACCTGCTTGG + Intergenic
1160488115 18:79311956-79311978 TGCCACGAGGGAAGGCTGCATGG - Intronic
1163526573 19:17824962-17824984 GTATATGAGGGAAGGCTGCAAGG + Exonic
1165798760 19:38534948-38534970 GTATACAAGGGGAAGCTGCAAGG - Intronic
1165849062 19:38838644-38838666 GGCCACAGGGGAAAGCTTCAGGG - Intronic
1168275735 19:55277363-55277385 GTACAAGAGGGAAAGTGGCATGG - Intronic
927528040 2:23766604-23766626 CTGCACCAGGGAAAGCTGGATGG + Intronic
929011502 2:37449793-37449815 GTCCAGGAAGGAAGGCTGCCTGG - Intergenic
929220124 2:39455294-39455316 GTCCATGAGGAAAATCTCCAGGG - Intergenic
929877998 2:45813113-45813135 TTCCAGGAGGCAAAACTGCAGGG + Intronic
936954028 2:118006388-118006410 GTCTTCGAGAGAAAGCAGCATGG - Intronic
937147909 2:119663255-119663277 ATCCAAAAGGGAAGGCTGCATGG - Intergenic
937865333 2:126747222-126747244 GGCCACAAGGGAAAGCTTCTTGG - Intergenic
938974579 2:136463591-136463613 ATCCACTAAGGAAGGCTGCAAGG - Intergenic
940781019 2:157933720-157933742 GTCCACAAGGGAAGGCAGAATGG + Intronic
946167444 2:217873592-217873614 GTCCATGAGGGCCACCTGCAGGG + Intronic
946201409 2:218072849-218072871 GTTCAGGAGGCAAAGCTGCAGGG - Exonic
948293932 2:236847231-236847253 GGCCACGAGGGAAAGGACCAGGG + Intergenic
1171325710 20:24290565-24290587 TTCCAGCAGGGAAAGCTGCCAGG - Intergenic
1173814156 20:45974314-45974336 GTCCACACGGGAAAACTGCCTGG - Intergenic
1174722610 20:52829617-52829639 GTCTAAGAGGGAGAGTTGCAGGG - Intergenic
1175142117 20:56868572-56868594 GCCCAGGAGGCAAAGCTGCTTGG + Intergenic
1175969745 20:62678844-62678866 TTCCAAAAGGCAAAGCTGCAGGG + Intronic
1180762895 22:18222818-18222840 GTCCAAGAGAGACAGCTGCGAGG + Intergenic
1180772750 22:18401729-18401751 GTCCAAGAGAGACAGCTGCGAGG - Intergenic
1180804130 22:18651345-18651367 GTCCAAGAGAGACAGCTGCGAGG - Intergenic
1180806645 22:18718132-18718154 GTCCAAGAGAGACAGCTGCGAGG + Intergenic
1181217590 22:21343914-21343936 GTCCAAGAGAGACAGCTGCGAGG + Intergenic
1203234586 22_KI270731v1_random:142717-142739 GTCCAAGAGAGACAGCTGCGAGG - Intergenic
951375351 3:21908290-21908312 TTCCAGGATGCAAAGCTGCATGG + Intronic
961567808 3:127776108-127776130 GCCCATGAGGGAGAGGTGCACGG - Intronic
963649418 3:147959162-147959184 GTCCAAGAAGGAAAACTGCGAGG + Intergenic
971013528 4:22464650-22464672 GTGCCCAAGAGAAAGCTGCATGG - Intronic
985493117 5:190765-190787 GTGCGGCAGGGAAAGCTGCAGGG - Intergenic
987761506 5:22168672-22168694 GTCCATATGTGAAAGCTGCAAGG - Intronic
989085485 5:37672176-37672198 GTGCACGGTGGAAAGCCGCAGGG + Intronic
991896294 5:71402139-71402161 GTCCATATGTGAAAGCTGCAAGG - Intergenic
1006391512 6:33761612-33761634 GTGCACCAGGGCAGGCTGCAGGG + Intergenic
1007292395 6:40797447-40797469 GTCCAGGAGGGAGCACTGCAGGG - Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1010470057 6:76216960-76216982 CTCCAGGAGCCAAAGCTGCATGG + Intergenic
1013418891 6:109948815-109948837 GGCCATGAGGAAAAGCAGCAGGG + Intergenic
1018742347 6:166739809-166739831 GACCACGAGTGGAAGCTGCACGG - Intronic
1022684032 7:32577967-32577989 GTGCATGAGGGAGAGCTACAGGG + Intronic
1024300443 7:47883523-47883545 GGCCACATGGGGAAGCTGCAGGG - Intronic
1024582294 7:50809856-50809878 CTCCAGGAGGGACACCTGCAGGG + Intergenic
1033377899 7:140781575-140781597 GTCTACAAGGGAAAGTGGCATGG - Exonic
1036796758 8:11761680-11761702 GTCCACGAGTGAGAGCTGGGGGG - Exonic
1037894194 8:22641014-22641036 CTCCACTGGGGAAAGATGCACGG + Intronic
1040987996 8:53317390-53317412 GGGCATGAGGTAAAGCTGCAGGG + Intergenic
1043799803 8:84593937-84593959 GTCCATGAGGCAAAGCTACAAGG - Intronic
1050272286 9:3959143-3959165 GGCCACGAGGGCATTCTGCAAGG + Intronic
1050423349 9:5489896-5489918 GGCCAGGAAGGAAAGCTGGAGGG + Intergenic
1050566433 9:6889124-6889146 TTCCAAGATGGAAAGCAGCAAGG - Intronic
1053576364 9:39359706-39359728 GTCCACAGGTGAAAGCAGCAAGG + Exonic
1053840875 9:42187631-42187653 GTCCACAGGTGAAAGCAGCAAGG + Exonic
1054119335 9:61194027-61194049 GTCCACAGGTGAAAGCAGCAAGG + Exonic
1054458538 9:65449718-65449740 GTCTACCAGGCACAGCTGCAGGG - Intergenic
1054588419 9:66988535-66988557 GTCCACAGGTGAAAGCAGCAAGG - Intergenic
1055132482 9:72792304-72792326 GTCCTCGAGGTACATCTGCAGGG - Exonic
1055986448 9:82059728-82059750 GTCCACAGGTGAAAGCAGCAAGG - Intergenic
1056584893 9:87921404-87921426 GTCCACAGGTGAAAGCAGCAAGG + Intergenic
1056611988 9:88131536-88131558 GTCCACAGGTGAAAGCAGCAAGG - Intergenic
1057160718 9:92886461-92886483 GTCCACAGGTGAAAGCAGCAAGG + Intergenic
1058678979 9:107425213-107425235 GTGCACGTGGGAAAGCAGCGTGG + Intergenic
1061858034 9:133453864-133453886 GTCCAAGAGGCAGCGCTGCAGGG + Intronic
1186262529 X:7794664-7794686 GGACAAGAGTGAAAGCTGCAAGG + Intergenic
1186723465 X:12330606-12330628 GACCACTAGGGAAAACTCCATGG - Intronic
1192909097 X:75584204-75584226 GTCTACAAGGGAAAGTGGCATGG + Intergenic
1194289167 X:92047928-92047950 GTGCACAATGGAAAGCTGCCTGG + Intronic
1198669675 X:139066203-139066225 GCCCACGAGAGAAAGCAGGAAGG + Intronic
1200606683 Y:5272506-5272528 GTGCACAATGGAAAGCTGCCTGG + Intronic