ID: 1087836228

View in Genome Browser
Species Human (GRCh38)
Location 11:102878061-102878083
Sequence TGGGGGTCCCAGCAAAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087836228_1087836229 -10 Left 1087836228 11:102878061-102878083 CCATGTCTTTGCTGGGACCCCCA No data
Right 1087836229 11:102878074-102878096 GGGACCCCCAGCTTCCAGTCTGG No data
1087836228_1087836230 -9 Left 1087836228 11:102878061-102878083 CCATGTCTTTGCTGGGACCCCCA No data
Right 1087836230 11:102878075-102878097 GGACCCCCAGCTTCCAGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087836228 Original CRISPR TGGGGGTCCCAGCAAAGACA TGG (reversed) Intergenic
No off target data available for this crispr