ID: 1087841695

View in Genome Browser
Species Human (GRCh38)
Location 11:102927402-102927424
Sequence CTGGCTAGACATATACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087841695_1087841697 -9 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841697 11:102927416-102927438 TCTAGCCAGATGCTTTGGCCAGG No data
1087841695_1087841704 20 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841704 11:102927445-102927467 GGATCCTGTGGGAGAGAACATGG No data
1087841695_1087841701 8 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841701 11:102927433-102927455 GCCAGGACAGTGGGATCCTGTGG No data
1087841695_1087841700 -1 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841700 11:102927424-102927446 GATGCTTTGGCCAGGACAGTGGG No data
1087841695_1087841699 -2 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841699 11:102927423-102927445 AGATGCTTTGGCCAGGACAGTGG No data
1087841695_1087841703 9 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841703 11:102927434-102927456 CCAGGACAGTGGGATCCTGTGGG No data
1087841695_1087841705 23 Left 1087841695 11:102927402-102927424 CCAGACTGTATATGTCTAGCCAG No data
Right 1087841705 11:102927448-102927470 TCCTGTGGGAGAGAACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087841695 Original CRISPR CTGGCTAGACATATACAGTC TGG (reversed) Intergenic
No off target data available for this crispr