ID: 1087846641

View in Genome Browser
Species Human (GRCh38)
Location 11:102980981-102981003
Sequence ATATAAAAGATAATGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087846639_1087846641 28 Left 1087846639 11:102980930-102980952 CCTGCATGTTCTGCACATGTATC 0: 984
1: 3153
2: 6771
3: 12814
4: 16025
Right 1087846641 11:102980981-102981003 ATATAAAAGATAATGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087846641 Original CRISPR ATATAAAAGATAATGCAGGT TGG Intergenic
No off target data available for this crispr