ID: 1087849024

View in Genome Browser
Species Human (GRCh38)
Location 11:103006955-103006977
Sequence ACCAGTTGGCTCCACTCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087849018_1087849024 23 Left 1087849018 11:103006909-103006931 CCATGTGCCAAGCATCATGTATA No data
Right 1087849024 11:103006955-103006977 ACCAGTTGGCTCCACTCTTATGG No data
1087849020_1087849024 -5 Left 1087849020 11:103006937-103006959 CCACCACACACCAGAACAACCAG No data
Right 1087849024 11:103006955-103006977 ACCAGTTGGCTCCACTCTTATGG No data
1087849019_1087849024 16 Left 1087849019 11:103006916-103006938 CCAAGCATCATGTATATTTAGCC No data
Right 1087849024 11:103006955-103006977 ACCAGTTGGCTCCACTCTTATGG No data
1087849021_1087849024 -8 Left 1087849021 11:103006940-103006962 CCACACACCAGAACAACCAGTTG No data
Right 1087849024 11:103006955-103006977 ACCAGTTGGCTCCACTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087849024 Original CRISPR ACCAGTTGGCTCCACTCTTA TGG Intergenic