ID: 1087849179

View in Genome Browser
Species Human (GRCh38)
Location 11:103009176-103009198
Sequence AGATGCACCCTGCAGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087849179_1087849182 24 Left 1087849179 11:103009176-103009198 CCTGCATTCTGCAGGGTGCATCT No data
Right 1087849182 11:103009223-103009245 TGAGAGCCTGTGACATTTCCAGG No data
1087849179_1087849180 -3 Left 1087849179 11:103009176-103009198 CCTGCATTCTGCAGGGTGCATCT No data
Right 1087849180 11:103009196-103009218 TCTCCTGTAGCTGCTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087849179 Original CRISPR AGATGCACCCTGCAGAATGC AGG (reversed) Intergenic
No off target data available for this crispr