ID: 1087851435 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:103034660-103034682 |
Sequence | CTGTATTTTTAGTAGAGATT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1087851435_1087851441 | 28 | Left | 1087851435 | 11:103034660-103034682 | CCCAATCTCTACTAAAAATACAG | No data | ||
Right | 1087851441 | 11:103034711-103034733 | TGTAGTCCCAGCTACTCTGGAGG | No data | ||||
1087851435_1087851440 | 25 | Left | 1087851435 | 11:103034660-103034682 | CCCAATCTCTACTAAAAATACAG | No data | ||
Right | 1087851440 | 11:103034708-103034730 | GTTTGTAGTCCCAGCTACTCTGG | No data | ||||
1087851435_1087851438 | -6 | Left | 1087851435 | 11:103034660-103034682 | CCCAATCTCTACTAAAAATACAG | No data | ||
Right | 1087851438 | 11:103034677-103034699 | ATACAGAAATTAGCCAGGCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1087851435 | Original CRISPR | CTGTATTTTTAGTAGAGATT GGG (reversed) | Intergenic | ||