ID: 1087851436

View in Genome Browser
Species Human (GRCh38)
Location 11:103034661-103034683
Sequence TCTGTATTTTTAGTAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851436_1087851440 24 Left 1087851436 11:103034661-103034683 CCAATCTCTACTAAAAATACAGA No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG No data
1087851436_1087851441 27 Left 1087851436 11:103034661-103034683 CCAATCTCTACTAAAAATACAGA No data
Right 1087851441 11:103034711-103034733 TGTAGTCCCAGCTACTCTGGAGG No data
1087851436_1087851438 -7 Left 1087851436 11:103034661-103034683 CCAATCTCTACTAAAAATACAGA No data
Right 1087851438 11:103034677-103034699 ATACAGAAATTAGCCAGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851436 Original CRISPR TCTGTATTTTTAGTAGAGAT TGG (reversed) Intergenic