ID: 1087851439

View in Genome Browser
Species Human (GRCh38)
Location 11:103034690-103034712
Sequence CAAACACTCATCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851439_1087851441 -2 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851441 11:103034711-103034733 TGTAGTCCCAGCTACTCTGGAGG No data
1087851439_1087851445 27 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data
1087851439_1087851440 -5 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG No data
1087851439_1087851446 30 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851446 11:103034743-103034765 GAGAATCACCTGAGCCCAGGAGG No data
1087851439_1087851443 4 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851443 11:103034717-103034739 CCCAGCTACTCTGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851439 Original CRISPR CAAACACTCATCACCACGCC TGG (reversed) Intergenic