ID: 1087851439

View in Genome Browser
Species Human (GRCh38)
Location 11:103034690-103034712
Sequence CAAACACTCATCACCACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851439_1087851443 4 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851443 11:103034717-103034739 CCCAGCTACTCTGGAGGCTGAGG 0: 8482
1: 204029
2: 270755
3: 182470
4: 97733
1087851439_1087851441 -2 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851441 11:103034711-103034733 TGTAGTCCCAGCTACTCTGGAGG 0: 4222
1: 106815
2: 237506
3: 242608
4: 147582
1087851439_1087851440 -5 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG 0: 91
1: 4511
2: 89404
3: 215259
4: 246336
1087851439_1087851446 30 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851446 11:103034743-103034765 GAGAATCACCTGAGCCCAGGAGG 0: 186
1: 3127
2: 33144
3: 85284
4: 159841
1087851439_1087851445 27 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851439 Original CRISPR CAAACACTCATCACCACGCC TGG (reversed) Intergenic
No off target data available for this crispr