ID: 1087851440

View in Genome Browser
Species Human (GRCh38)
Location 11:103034708-103034730
Sequence GTTTGTAGTCCCAGCTACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851435_1087851440 25 Left 1087851435 11:103034660-103034682 CCCAATCTCTACTAAAAATACAG No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG No data
1087851439_1087851440 -5 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG No data
1087851436_1087851440 24 Left 1087851436 11:103034661-103034683 CCAATCTCTACTAAAAATACAGA No data
Right 1087851440 11:103034708-103034730 GTTTGTAGTCCCAGCTACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851440 Original CRISPR GTTTGTAGTCCCAGCTACTC TGG Intergenic