ID: 1087851443 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:103034717-103034739 |
| Sequence | CCCAGCTACTCTGGAGGCTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1087851439_1087851443 | 4 | Left | 1087851439 | 11:103034690-103034712 | CCAGGCGTGGTGATGAGTGTTTG | No data | ||
| Right | 1087851443 | 11:103034717-103034739 | CCCAGCTACTCTGGAGGCTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1087851443 | Original CRISPR | CCCAGCTACTCTGGAGGCTG AGG | Intergenic | ||