ID: 1087851443

View in Genome Browser
Species Human (GRCh38)
Location 11:103034717-103034739
Sequence CCCAGCTACTCTGGAGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851439_1087851443 4 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851443 11:103034717-103034739 CCCAGCTACTCTGGAGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851443 Original CRISPR CCCAGCTACTCTGGAGGCTG AGG Intergenic