ID: 1087851444

View in Genome Browser
Species Human (GRCh38)
Location 11:103034718-103034740
Sequence GCCTCAGCCTCCAGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851444_1087851446 2 Left 1087851444 11:103034718-103034740 CCAGCTACTCTGGAGGCTGAGGC No data
Right 1087851446 11:103034743-103034765 GAGAATCACCTGAGCCCAGGAGG No data
1087851444_1087851445 -1 Left 1087851444 11:103034718-103034740 CCAGCTACTCTGGAGGCTGAGGC No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data
1087851444_1087851447 5 Left 1087851444 11:103034718-103034740 CCAGCTACTCTGGAGGCTGAGGC No data
Right 1087851447 11:103034746-103034768 AATCACCTGAGCCCAGGAGGTGG No data
1087851444_1087851448 8 Left 1087851444 11:103034718-103034740 CCAGCTACTCTGGAGGCTGAGGC No data
Right 1087851448 11:103034749-103034771 CACCTGAGCCCAGGAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851444 Original CRISPR GCCTCAGCCTCCAGAGTAGC TGG (reversed) Intergenic