ID: 1087851445

View in Genome Browser
Species Human (GRCh38)
Location 11:103034740-103034762
Sequence CATGAGAATCACCTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087851439_1087851445 27 Left 1087851439 11:103034690-103034712 CCAGGCGTGGTGATGAGTGTTTG No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data
1087851442_1087851445 0 Left 1087851442 11:103034717-103034739 CCCAGCTACTCTGGAGGCTGAGG No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data
1087851444_1087851445 -1 Left 1087851444 11:103034718-103034740 CCAGCTACTCTGGAGGCTGAGGC No data
Right 1087851445 11:103034740-103034762 CATGAGAATCACCTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087851445 Original CRISPR CATGAGAATCACCTGAGCCC AGG Intergenic