ID: 1087853447

View in Genome Browser
Species Human (GRCh38)
Location 11:103060536-103060558
Sequence TTGGGTATACACAAGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087853442_1087853447 14 Left 1087853442 11:103060499-103060521 CCACAGGGATGACTGTAGGACTT No data
Right 1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087853447 Original CRISPR TTGGGTATACACAAGGGTCC TGG Intergenic
No off target data available for this crispr