ID: 1087863848

View in Genome Browser
Species Human (GRCh38)
Location 11:103198435-103198457
Sequence CTTAGACATCTGGACTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087863848_1087863854 6 Left 1087863848 11:103198435-103198457 CCCAGGTAGTCCAGATGTCTAAG 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1087863854 11:103198464-103198486 CCAGATGATGTTGATGCTGCTGG 0: 6
1: 62
2: 377
3: 959
4: 2047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087863848 Original CRISPR CTTAGACATCTGGACTACCT GGG (reversed) Intronic
900202865 1:1419175-1419197 CTCAGGCATCTGGGCCACCTCGG + Exonic
902895108 1:19474313-19474335 CTTAATCCTCTGGACTACCCTGG + Intronic
906224959 1:44114084-44114106 CGTGGACATCTGGAATGCCTGGG - Intergenic
909001431 1:70221731-70221753 ATTAGTCACCTGGATTACCTCGG - Exonic
917174013 1:172211279-172211301 CTTAGACAGCTGAGTTACCTAGG - Intronic
923818285 1:237404755-237404777 CTAAGACTTCAGGACTACCCTGG - Intronic
1069697479 10:70397518-70397540 CTTTGACATCAGGCATACCTTGG - Intergenic
1072253438 10:93600004-93600026 CTGAGACAGCTTGACTATCTGGG - Intronic
1073289569 10:102406865-102406887 CTGTGACATCTGGGCTCCCTAGG + Intronic
1074234723 10:111573704-111573726 CTTAGATCTCTGAACTGCCTTGG + Intergenic
1077599368 11:3563003-3563025 CTTAGACATCAGGGCTAACATGG + Intergenic
1078465697 11:11548520-11548542 CTCTGACATCTGGACCTCCTGGG + Intronic
1078531548 11:12140332-12140354 CTTAGACAGCTGCATTGCCTTGG - Intronic
1078554964 11:12317161-12317183 CTGAGACAGCTGGAATACGTGGG - Intronic
1079804641 11:24914293-24914315 GTCAGACCTCTGGACAACCTAGG - Intronic
1081058345 11:38439208-38439230 CTTCAACAGCTGGACTTCCTGGG - Intergenic
1081725934 11:45329149-45329171 CTGAGCCATCAGGACTGCCTTGG + Intergenic
1082852435 11:57777383-57777405 CTTAGCCACCTGGAGTAGCTTGG + Intronic
1084255274 11:67937607-67937629 CTTAGACATCAGGGCTAACATGG + Intergenic
1086457596 11:86974693-86974715 CTTAAACATCTGTTCTTCCTGGG + Intergenic
1086589226 11:88492616-88492638 CTTAGTCCTCTGGAAAACCTAGG + Intergenic
1087863848 11:103198435-103198457 CTTAGACATCTGGACTACCTGGG - Intronic
1092425509 12:8372350-8372372 CTTAGACATCAGGGCTAACGTGG + Intergenic
1098694666 12:73537645-73537667 CTAAGCCATCTGAACTCCCTGGG + Intergenic
1108587477 13:51883119-51883141 CTTAGACCTCAGGACTCCCTGGG - Intergenic
1108848274 13:54700379-54700401 CAAAGCCATCTGGACTACCTGGG + Intergenic
1114185240 14:20396233-20396255 CTTAGGCAGGTGGACTGCCTGGG + Intronic
1115985033 14:39096233-39096255 CTTAGAAATCAGGACCAGCTGGG + Intronic
1116084790 14:40221064-40221086 CTTATACAACTGGACTTTCTGGG - Intergenic
1125649506 15:41303397-41303419 TTCAGACATCTGCACTATCTGGG + Intergenic
1125773208 15:42186314-42186336 GGTAGGCATCTGGGCTACCTGGG + Intronic
1126207333 15:46060223-46060245 CTTAGACCTCTTGGCTACTTCGG + Intergenic
1129678673 15:77645896-77645918 CTTAGACACCTCCACTGCCTGGG + Intronic
1132577843 16:672115-672137 CTTGGACACCTAGGCTACCTGGG + Exonic
1141002941 16:80325033-80325055 GTTAGACATCTTGACTTCCCAGG + Intergenic
1149679771 17:58497786-58497808 CTTAGACATCCAGACAACCAGGG + Intronic
1155857786 18:30855301-30855323 CCTAGGCATCTGGAGTAGCTAGG - Intergenic
1164121049 19:22265811-22265833 CTAAGTCATCTGAACTCCCTTGG + Intergenic
1164379114 19:27717240-27717262 TAAAGACATCTGGGCTACCTTGG - Intergenic
934948509 2:98559790-98559812 GGTACACATCTGGACTTCCTGGG + Intronic
936158037 2:110062598-110062620 ATTAGAATTCTGGACTAACTTGG + Intergenic
936186655 2:110308849-110308871 ATTAGAATTCTGGACTAACTTGG - Intergenic
942752652 2:179305466-179305488 CCTAGACTTCTGGATTGCCTGGG - Intergenic
943468828 2:188266326-188266348 CTTAGAAGCCAGGACTACCTGGG - Intergenic
945673603 2:212831320-212831342 CTTGGACAGCTGTAGTACCTCGG - Intergenic
1171071884 20:22077876-22077898 CATAGACATATGGATTACTTTGG + Intergenic
1173367429 20:42399601-42399623 GTTAAGCATCTGGATTACCTGGG - Intronic
1175542830 20:59758743-59758765 CTTTGACATCAGGCCGACCTGGG + Intronic
1180697091 22:17758527-17758549 GTTAGACATCTGGACTATTTTGG - Intronic
1181561588 22:23706050-23706072 CTGAGACATCCAGACTACATCGG + Intergenic
1183038158 22:35155857-35155879 CACAGACAGCTGGACTGCCTGGG + Intergenic
1185209530 22:49562269-49562291 CCCAGATATCTGGACTTCCTGGG - Intronic
950751257 3:15130133-15130155 CTTAGACATCAGGGCTAACATGG - Intergenic
951470692 3:23052843-23052865 ATTAGTCATCTTGACTAGCTGGG - Intergenic
955287506 3:57657064-57657086 CCTATACATCAGAACTACCTGGG + Intronic
961283898 3:125784879-125784901 CTTAGACATCAGGGCTAACATGG - Intergenic
969013808 4:4089311-4089333 CTTAGACATCAGGGCTAACATGG + Intergenic
972059907 4:34856539-34856561 CTAAGGGATCTGAACTACCTTGG - Intergenic
974672203 4:65046755-65046777 ATTAGACATCTGGACAAACTTGG + Intergenic
975136736 4:70882153-70882175 CTTTGACACATGGACTACCAAGG - Intergenic
977563753 4:98561037-98561059 CTGAGACATGTGGTCTAGCTGGG - Intronic
980785489 4:137548796-137548818 CCTAGATATCTCGTCTACCTTGG - Intergenic
988877202 5:35459689-35459711 CTTAGGCCTCTGGAATAGCTGGG + Intergenic
994594779 5:101818636-101818658 CTTAGATCTCTTGACTACTTGGG - Intergenic
995425205 5:112013661-112013683 CTCAGACATCAGGACTTCCATGG - Intergenic
1008117030 6:47563195-47563217 CTTGCACCTCTGGACTACATAGG - Intronic
1008603682 6:53119872-53119894 CTTAGACATCTGGGCTGGGTTGG - Intergenic
1010229498 6:73521849-73521871 CCTGGACATCTGGAGTACCAGGG - Intronic
1011370044 6:86627191-86627213 CTGAGCCATCATGACTACCTTGG + Intergenic
1011586016 6:88925915-88925937 CTTAGACATTTTGATTACGTAGG + Intronic
1015496668 6:133889956-133889978 CTTACACATCTCGACCACCGCGG + Intronic
1017932444 6:158969990-158970012 GTTAAAAATCTGGACTTCCTTGG + Intergenic
1020762899 7:12290075-12290097 CTCAGACCTCGGGACTCCCTGGG + Intergenic
1025005601 7:55352182-55352204 CTTTGAAATCTGGGCTTCCTGGG + Intergenic
1026301694 7:69103451-69103473 CCTAGACCTCTGGAGTAGCTGGG - Intergenic
1027946009 7:84747397-84747419 CTTAGACATCTGGACTTGAGGGG + Intergenic
1029072462 7:97910936-97910958 CTTAGACATCAGGGCTAACATGG + Intergenic
1031771372 7:125848388-125848410 CTTAGGCAGCTCCACTACCTTGG - Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1036245204 8:7110363-7110385 CTTAGACATCAGGGCTAACATGG - Intergenic
1036255550 8:7203438-7203460 CTTAGACATCAGGGCTAACATGG + Intergenic
1036361938 8:8084065-8084087 CTTAGACATCAGGGCTAACATGG - Intergenic
1036889031 8:12582963-12582985 CTTAGACATCAGGGCTAACATGG + Intergenic
1037527803 8:19744426-19744448 GTTGGACATCTGGACTCTCTGGG - Intronic
1041346320 8:56902167-56902189 CTCAGACCTCAGGACTCCCTGGG - Intergenic
1041664116 8:60425692-60425714 CTTAGACATCTGTAACACTTTGG + Intergenic
1049398043 8:142410994-142411016 CTTACACACCTGGTCTCCCTGGG + Intergenic
1055319356 9:75067214-75067236 CTTATACATCAGGATCACCTGGG + Intronic
1055467948 9:76583802-76583824 CTTAGACCCCTAGATTACCTGGG - Intergenic
1057167729 9:92941786-92941808 CTTTGACATCTGGACTTTGTGGG - Intergenic
1059090938 9:111357144-111357166 CTTACACATCTGGATCATCTTGG - Intergenic
1185578294 X:1191059-1191081 CTTGGCCAACTGGACTACCAGGG + Exonic
1187246469 X:17557197-17557219 CTCACACATCTGGACTGCCAAGG - Intronic
1187286741 X:17912544-17912566 CTTAGACAGCTGTCCTATCTAGG - Intergenic
1190462437 X:50691892-50691914 CCTTCACATGTGGACTACCTTGG - Intronic
1194123415 X:89987308-89987330 ATTAGACCTCTGGACTCCCCGGG - Intergenic
1196777635 X:119354760-119354782 CTAAAACATATGGACTACTTTGG - Intergenic
1200476301 Y:3644925-3644947 ATTAGACCTCTGGACTCCCCGGG - Intergenic