ID: 1087868930

View in Genome Browser
Species Human (GRCh38)
Location 11:103267004-103267026
Sequence CAGCTGATGTGGAGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 2, 1: 42, 2: 63, 3: 91, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087868930 Original CRISPR CAGCTGATGTGGAGCCCAGG GGG (reversed) Intronic
900649550 1:3724146-3724168 GAGCTGATGTGGGGCCCAACTGG + Intronic
900910355 1:5593105-5593127 CAGCTGATGAGGAGCCAGAGAGG + Intergenic
902805928 1:18861367-18861389 CAGCTGATGTCAAATCCAGGTGG - Intronic
902968412 1:20029162-20029184 CAGCAGATGTGGAAACCAGAAGG + Intronic
903184680 1:21622438-21622460 CAGCTGAAGTGCCGCCCCGGCGG - Intronic
903337646 1:22635585-22635607 CAGCTGCAGTGGTTCCCAGGAGG + Intergenic
904438194 1:30512909-30512931 CAGCTGGTGTGGAGCAGAGGTGG - Intergenic
906851039 1:49250897-49250919 CAGCTGATGTGGAGCTCACAGGG + Intronic
907722378 1:56983989-56984011 CAGGTAACGTGGAGCCAAGGAGG + Intergenic
908818318 1:68057013-68057035 CAGCTGATGTGGAGCACAGAGGG + Intergenic
909024539 1:70467722-70467744 CAGCTAATATGAAGCCCAGAGGG + Intergenic
909203510 1:72724941-72724963 CAGCTGATGTGGAGCCCAGCGGG + Intergenic
910200336 1:84691648-84691670 TAGCTGCTGTTGAGCCCAGGTGG + Intergenic
912420235 1:109537710-109537732 CAGCTCATGTGGTGGCCAGCAGG - Intergenic
912456645 1:109802663-109802685 CAGCTGCCCTGGAGCCCAGTGGG + Intergenic
912887220 1:113488234-113488256 CAGCTGATGTGGATCCCAAAGGG + Intronic
913349500 1:117842307-117842329 CAGCTGAAGTGGAGCCTGGAGGG + Intergenic
913580837 1:120225113-120225135 GATCTGAGGTGGAGCCAAGGTGG - Intergenic
913627341 1:120673286-120673308 GATCTGAGGTGGAGCCAAGGTGG + Intergenic
914562769 1:148836551-148836573 GATCTGAGGTGGAGCCAAGGTGG - Intronic
914610060 1:149293671-149293693 GATCTGAGGTGGAGCCAAGGTGG + Intergenic
915049102 1:153049186-153049208 CAGCTGATGTGGAGCCTAAAGGG + Intergenic
915051851 1:153083818-153083840 CAGCTGACGTGGAACCCAAGGGG + Intergenic
915053447 1:153102799-153102821 CAGCTGATGTGGAGCCTAAAGGG + Intronic
915284195 1:154842454-154842476 CAGGTGATGTGAAGCTCAGGAGG - Intronic
915473348 1:156138589-156138611 CAGCGGCTCAGGAGCCCAGGTGG + Exonic
915896488 1:159815237-159815259 CAGCTGGTGTGTAGTCCAGCTGG + Intronic
918126160 1:181585855-181585877 CAGATCATGTGGAGCCCTGAAGG + Intronic
918826844 1:189336086-189336108 CAGCCTATGTGGAGCCCATATGG + Intergenic
919207551 1:194437127-194437149 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
919568565 1:199219025-199219047 CAGCTGACATAGAGCCCAGAGGG - Intergenic
919755398 1:201062995-201063017 CAGCAGAGTTGGAGCCCAGCTGG + Intronic
920287911 1:204894619-204894641 GAGCTGAAGGGGAGGCCAGGAGG - Intronic
920787004 1:209051310-209051332 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
921404670 1:214765480-214765502 CAGCTGATGTGGGGCCCAGAGGG - Intergenic
921713416 1:218395269-218395291 CACCTGATGTGGAGACCTGGGGG - Intronic
921800813 1:219399916-219399938 CAGCTGATGTAGAGACCAGCGGG - Intergenic
922036239 1:221851323-221851345 CAGCTGGTGAGGAGACCTGGGGG + Intergenic
922050837 1:221989348-221989370 CAGATGAGGTGGAGGGCAGGTGG - Intergenic
922538583 1:226402040-226402062 CAGATGATGCTGAGTCCAGGAGG + Intronic
922679493 1:227579931-227579953 CAGCTGATGCAGAGCCCAAAGGG - Intronic
923012139 1:230096203-230096225 CAGCTGAGGTTGAGCCATGGTGG + Intronic
923104114 1:230841285-230841307 GCACTGATGTGGAGCCGAGGTGG + Intronic
923273395 1:232377027-232377049 GAGCTGGGGTGGAGACCAGGAGG + Intergenic
923542601 1:234899282-234899304 AGGCTGACGTGGAGGCCAGGCGG - Intergenic
923855208 1:237838751-237838773 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
924224206 1:241907616-241907638 CAGCTCAGGTGAAGCCTAGGAGG + Intergenic
924821077 1:247491365-247491387 CAGCTGCTGTGGAACCTGGGGGG + Intergenic
1063160162 10:3412974-3412996 CAGCTGATGGGGAGCTCCGGAGG - Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1065889686 10:30110381-30110403 CAGCTGATGTGTGGACCAGCTGG + Intronic
1066670196 10:37829097-37829119 CATCTGCTGGAGAGCCCAGGTGG - Exonic
1067661876 10:48242195-48242217 CTTCTGATGTGGAGACCAGCAGG + Exonic
1068463030 10:57351531-57351553 CAGCTCATGTAGAGCCAAGAGGG - Intergenic
1069806071 10:71125807-71125829 CAGCTGATATGGAGCCCAGGGGG - Intergenic
1069845086 10:71365444-71365466 CAGTTAGTGTGGAGCACAGGGGG + Intergenic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1070684880 10:78472917-78472939 GAGCCCATTTGGAGCCCAGGGGG - Intergenic
1071091481 10:81924042-81924064 CAGGTGATTGGGAGCCCAGTAGG + Intronic
1071502835 10:86215675-86215697 GGGCTGAGGAGGAGCCCAGGAGG - Intronic
1071736143 10:88303226-88303248 CAGCTGATGTGGAGCCCAGATGG + Intronic
1074537654 10:114340228-114340250 CAGCTACTTGGGAGCCCAGGAGG + Intronic
1076983515 11:218747-218769 CACCTGATATGGAGCCCCGTTGG - Intronic
1077841718 11:5982704-5982726 CAGTCTATGTGGAGCCCAGAGGG - Intergenic
1077882774 11:6364079-6364101 CAGCAGATGCGAGGCCCAGGTGG - Intergenic
1078178086 11:8985717-8985739 CAGCTGCTGGGCAGTCCAGGCGG + Exonic
1078858324 11:15224724-15224746 CAGATTCTGTGGAGCCCATGGGG + Intronic
1079381513 11:19942307-19942329 GATCTGATGTAGAGCCCTGGAGG + Intronic
1079668295 11:23135000-23135022 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1080224921 11:29949867-29949889 CAGCTGATGTGGAGCACAGAGGG + Intergenic
1081866856 11:46364954-46364976 CACCTGCTGTGGGGCACAGGTGG + Intronic
1083263702 11:61536548-61536570 CAGCTCCTGTAGTGCCCAGGTGG + Intronic
1084363324 11:68683292-68683314 CATCTGATATTGAGCCCAGTGGG + Intergenic
1084392859 11:68890193-68890215 CAACCCATGTGGAGCCCTGGAGG + Intergenic
1084483029 11:69432972-69432994 CACCTGGTGTGGAACCCAGCAGG + Intergenic
1084486190 11:69449688-69449710 CAGCAGGTGTGCATCCCAGGGGG + Intergenic
1084956148 11:72692694-72692716 CAGCTCATTTGGCCCCCAGGTGG + Intronic
1085022259 11:73217286-73217308 CAGCTGATATGGAGCCCAAGAGG + Intergenic
1085640694 11:78190908-78190930 CAGCTGATGTGGGGCAGGGGTGG - Intronic
1085815040 11:79728199-79728221 TAGCTGATGTGGAGCCTAGAGGG - Intergenic
1085856530 11:80181852-80181874 CCGCTGATGTGGAGCCCACAGGG - Intergenic
1086462854 11:87022855-87022877 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087337558 11:96863697-96863719 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1087597534 11:100272906-100272928 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1087619828 11:100528644-100528666 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1087780009 11:102291706-102291728 CAGCAAGTGTGGAGCCCTGGAGG - Intergenic
1087868930 11:103267004-103267026 CAGCTGATGTGGAGCCCAGGGGG - Intronic
1088806622 11:113358679-113358701 CAGTTGATGTGGAGCCCAGAGGG - Intronic
1089305548 11:117524172-117524194 GAGCTGGTGTGGAGAGCAGGTGG - Intronic
1090050827 11:123377555-123377577 CAGCAGATGGGGAGACAAGGAGG + Intergenic
1090684434 11:129100122-129100144 CAGTTGATGTGGAGCCCAGAAGG + Intronic
1091037552 11:132247120-132247142 AAGTTCATGGGGAGCCCAGGAGG - Intronic
1091529499 12:1340399-1340421 CAGCTGAGGTGGAACCCAGAGGG - Intronic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092187162 12:6489116-6489138 CAGCTGCTGTGGAGGCTGGGTGG - Intergenic
1093496447 12:19763295-19763317 CAGCCTTTGTGGAGCCCAGAAGG + Intergenic
1095183589 12:39175357-39175379 GATCTGAGGTGGAGCTCAGGTGG - Intergenic
1095542807 12:43330314-43330336 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1097634174 12:62102054-62102076 AAGCTGAGGTGGAGAGCAGGTGG + Intronic
1097859782 12:64507305-64507327 AAGCTGCTCTGGAGCCAAGGTGG + Intergenic
1098678498 12:73321264-73321286 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1100888906 12:99102228-99102250 CAGCTCATGAGGACCCCAGGAGG + Intronic
1101922252 12:108942511-108942533 CAGCCAATGTGGAGCCCTGCAGG + Intronic
1102243138 12:111338110-111338132 CACCTGATGTGAAGCCGAGGGGG - Intronic
1102741538 12:115211672-115211694 CAGCGGATGTGAAGATCAGGTGG - Intergenic
1102919518 12:116781338-116781360 CAGCTGATGGGAAGCCCAAGAGG + Intronic
1103265313 12:119624885-119624907 TAACTGATGTGGGGACCAGGTGG - Intronic
1103938485 12:124489146-124489168 GACCTGAGGTGGAGCCCAAGGGG + Intronic
1104040206 12:125125005-125125027 TACCTGAGATGGAGCCCAGGAGG - Exonic
1104654509 12:130563914-130563936 CAGGTTATGTAGAGCCCAGCAGG - Intronic
1105396857 13:20044191-20044213 CAGCTGATCTGGAGCCCACAGGG - Intronic
1108342711 13:49513848-49513870 CAGCTGATGTTGGGGACAGGAGG - Intronic
1109326206 13:60870378-60870400 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1109667133 13:65553746-65553768 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1110939387 13:81330528-81330550 CAGCTGCTGTTGTGTCCAGGAGG - Intergenic
1111113711 13:83749450-83749472 CAGCTGATGCGGAGCCCAGAGGG + Intergenic
1111526415 13:89476665-89476687 CAGCTGATGTGAAGCCCAGAAGG - Intergenic
1113356036 13:109581039-109581061 CATGTGATATGGAGCCCAAGAGG - Intergenic
1113669462 13:112165821-112165843 CAGCTGATGTGAAGCCCAGTGGG + Intergenic
1114059059 14:19002290-19002312 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1114103484 14:19399464-19399486 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1114134645 14:19834223-19834245 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1114226773 14:20745822-20745844 CAGCTGATTGGTAGCCGAGGTGG - Intronic
1115601031 14:34956169-34956191 CACCTGATGTGGAGACCAGAGGG + Intergenic
1115883373 14:37945421-37945443 CAACTGATGTGGAGCCCAGATGG + Intronic
1116243483 14:42378771-42378793 CAGCTGATGTGTAGCCCAGAAGG + Intergenic
1118175955 14:63440227-63440249 GAGGTGAGGAGGAGCCCAGGAGG - Intronic
1118478488 14:66141177-66141199 CAGCTGATGTGAAGCCCAGAGGG + Intergenic
1118540042 14:66813625-66813647 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1119240942 14:73059011-73059033 TATCTAACGTGGAGCCCAGGGGG - Intronic
1119345921 14:73924300-73924322 CAGGAGAGGTGGAGCTCAGGTGG + Intronic
1119436683 14:74601992-74602014 GAGCTGATGTGGACCCAAGAGGG + Intronic
1122143861 14:99677374-99677396 CAGCTGATGGAGATCCCTGGGGG + Exonic
1123433703 15:20239404-20239426 TGGATGATGTGGAGTCCAGGAGG + Intergenic
1123496752 15:20834341-20834363 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123553986 15:21407933-21407955 CAGCTGATGTGGAGCCTGGAGGG - Intergenic
1123577698 15:21689797-21689819 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1123579972 15:21706150-21706172 CATCTGAGGTGGAGACCACGGGG - Intergenic
1123590231 15:21845298-21845320 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1123614322 15:22132278-22132300 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1123616620 15:22148772-22148794 CATCTGAGGTGGAGACCACGGGG - Intergenic
1123676512 15:22714870-22714892 CAGCCGCTGTGGCGCCCGGGCGG - Intergenic
1125100993 15:35912394-35912416 CTACTGATGAGGAGCCCATGTGG + Intergenic
1125184458 15:36914616-36914638 AAGCTGAAGTGGAGCCGAGAGGG + Intronic
1125367403 15:38932669-38932691 CAGCTCATGTGGAACCCAGAGGG - Intergenic
1125755387 15:42060722-42060744 CAGCTTGTTTGGAGCCAAGGGGG - Intergenic
1126225157 15:46261821-46261843 CAGCTGATGTGCAGATCAGAGGG - Intergenic
1126506263 15:49407160-49407182 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1126883385 15:53123210-53123232 CAGCTGGTGTGGAACAGAGGTGG - Intergenic
1127098214 15:55535050-55535072 CTGCTGAAGAGGAGCCCAGAGGG + Intergenic
1128842811 15:70863942-70863964 CAGCTGATGAGCAGCACAGAAGG - Intronic
1129235260 15:74219973-74219995 GTGCTGAAGTGGAGCCCAGGTGG + Intergenic
1129254729 15:74327678-74327700 CAGCTGAGTTGGAGAACAGGAGG + Intronic
1130445900 15:84001713-84001735 CAGGTGAGGTTGAGCCCTGGAGG - Intronic
1131520733 15:93112701-93112723 TAGGTGATGAGGTGCCCAGGAGG - Intergenic
1132244725 15:100285757-100285779 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
1202962334 15_KI270727v1_random:135129-135151 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1202986567 15_KI270727v1_random:424042-424064 TAGCCGATATGGAGCCCAGAGGG + Intergenic
1202988842 15_KI270727v1_random:440395-440417 CATCTGAGGTGGAGACCACGGGG - Intergenic
1132858930 16:2060509-2060531 CAGCAGGTGGGGCGCCCAGGAGG - Intronic
1133502111 16:6376382-6376404 TTGCTGTTCTGGAGCCCAGGAGG + Intronic
1134358661 16:13509049-13509071 AAGCTAATTTGGAGCCAAGGAGG - Intergenic
1134651316 16:15911151-15911173 AGGCTGAGGTGGAGCCCAGAAGG + Intergenic
1135165379 16:20134432-20134454 CAGATGATGTGGTCACCAGGTGG + Intergenic
1136402138 16:30024796-30024818 CGGGTGATGGGGAGCCCTGGGGG + Exonic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1137422211 16:48344808-48344830 CAGCTGCTGGGGAGCTGAGGTGG + Intronic
1138531367 16:57636087-57636109 GAGCCCATGGGGAGCCCAGGTGG + Intronic
1139801150 16:69523957-69523979 CAGCTGATGTCGGGCCCACTTGG + Intergenic
1141182800 16:81765857-81765879 CAGCTGCTGTGTAGCCAAGGTGG + Intronic
1142212967 16:88817085-88817107 CAGCTGATGTGGGTCCCAGCAGG - Intronic
1142353129 16:89588832-89588854 TAGCTGACCTGGAGACCAGGGGG - Intronic
1142353145 16:89588887-89588909 TAGCTGACCTGGAGACCAGGGGG - Intronic
1203112519 16_KI270728v1_random:1460163-1460185 CGGATGACGTGGAGTCCAGGAGG - Intergenic
1142548718 17:724168-724190 CAGCTACTTAGGAGCCCAGGAGG - Intergenic
1143011845 17:3870320-3870342 GAGCTGATGTGGCGCTGAGGGGG - Intronic
1143619862 17:8074577-8074599 AAGCTGTTGTGGTGTCCAGGAGG - Intronic
1143769802 17:9161407-9161429 CAGCTTATTTGGAGCCCTGAAGG + Intronic
1143981606 17:10874864-10874886 CATCTCATGGAGAGCCCAGGAGG + Intergenic
1144809525 17:17989751-17989773 CAGCTGAGGGAGACCCCAGGGGG + Intronic
1146455847 17:33009131-33009153 CAGCGTATGGGAAGCCCAGGAGG - Intergenic
1147120087 17:38330674-38330696 CAGCAGAGCTGGAGCCAAGGTGG + Exonic
1147690327 17:42310969-42310991 GAGCAGATGAGGGGCCCAGGAGG - Exonic
1148089227 17:45012925-45012947 CAGCTGATCTTGTGCCCAAGTGG - Intergenic
1149363646 17:55919235-55919257 CAGCTGCTGTGGAAAACAGGAGG + Intergenic
1152657358 17:81526194-81526216 AGGCTGAGGAGGAGCCCAGGCGG - Intergenic
1153399345 18:4666533-4666555 CAGCTGGTGTGAAGCCCAAAGGG + Intergenic
1153595510 18:6721189-6721211 CAGGTGGTGCAGAGCCCAGGAGG + Intergenic
1153961078 18:10140658-10140680 GAACTGAAGTGGTGCCCAGGAGG + Intergenic
1154034916 18:10791590-10791612 CAGCTGATTTCCTGCCCAGGTGG - Intronic
1154454659 18:14510025-14510047 CAGCTGATGTGGAGCCTGGAGGG - Intronic
1155073770 18:22338026-22338048 CAGCTGATATGGAGCAAAAGAGG + Intergenic
1156076193 18:33282286-33282308 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1160130181 18:76218444-76218466 CTGCTGGTGGGGAGCCCAGTAGG + Intergenic
1160295181 18:77630964-77630986 CAGCTGATGTTGAGCACCTGTGG + Intergenic
1161480433 19:4507736-4507758 AAGCTGTTGTGCAGCCCGGGAGG - Intronic
1161584009 19:5095476-5095498 CTGCTGCCTTGGAGCCCAGGGGG - Intronic
1165029916 19:32990516-32990538 TGGATGATGTGGAGTCCAGGAGG + Exonic
1166299449 19:41905819-41905841 CAGCTGATGGTGAGACCAGAGGG + Exonic
1168465528 19:56598279-56598301 CAGCAGATGCAGAGGCCAGGAGG + Intronic
1202636317 1_KI270706v1_random:47535-47557 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
925010858 2:484911-484933 CAGCAGATGTGGTGCCAAGTCGG - Intergenic
925220321 2:2134204-2134226 AACCTGATGTGGAAGCCAGGAGG - Intronic
927154880 2:20215817-20215839 GAGGTGTTGTGGAGGCCAGGAGG - Intronic
927212426 2:20646972-20646994 CAGCTGCTCCAGAGCCCAGGTGG + Intronic
928399060 2:30965005-30965027 CAGCTGATGTGCTGCTCAGCAGG + Intronic
928427439 2:31190883-31190905 CAGCTGCTGTGGCCGCCAGGAGG - Intronic
928933346 2:36648372-36648394 CAGCTGATGGTGAGACCAGGTGG + Intergenic
929381942 2:41364461-41364483 TAGCTGATATGAAGCCCAGAGGG + Intergenic
930028706 2:47045325-47045347 GAGCTGGGGTGGAGCCCTGGAGG - Intronic
930087589 2:47508804-47508826 CAGCTGATTGGCAGCCCAGCAGG + Intronic
930930300 2:56874579-56874601 CAGCTGTTGTGGAGCCCAGAGGG + Intergenic
931489270 2:62726176-62726198 CAGCTGATGTGGAGCTCAGAGGG - Intronic
932539613 2:72638734-72638756 CAGCTCATGTGGAGCCTAGAGGG + Intronic
933398833 2:81765660-81765682 CAGCTGATGGGGGAGCCAGGAGG - Intergenic
933555335 2:83823929-83823951 CAGCTGATGTGAAGCCTAGATGG - Intergenic
933599372 2:84314492-84314514 CAGGTGATGCGAATCCCAGGGGG + Intergenic
933647690 2:84825783-84825805 GAGAGGATGTGGAGCTCAGGTGG - Intronic
933782236 2:85810827-85810849 CACCTTATCTGCAGCCCAGGTGG + Intergenic
934099614 2:88640733-88640755 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
935449171 2:103189761-103189783 CAGCTGATGTGGAGCCCAAAAGG + Intergenic
935711384 2:105902136-105902158 CAACTGATGCAGAGCCCAGAGGG - Intergenic
935847944 2:107187310-107187332 CAGCTGATTAGGAGCCCAGAGGG + Intergenic
935888301 2:107648502-107648524 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
936428133 2:112436511-112436533 CAGCTGATGTGCAGGGCCGGGGG - Intergenic
936593246 2:113823543-113823565 AGGCTGAGGTGGGGCCCAGGAGG + Intergenic
936909150 2:117572449-117572471 CTGCTGAGGTGGAGCCCAAGGGG - Intergenic
937195857 2:120156030-120156052 CAGCTGATGTGGAGCCCAGAGGG + Intronic
937569105 2:123334358-123334380 TAGTTGATGTGGAGCCCAGAGGG + Intergenic
938477530 2:131629549-131629571 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
939199768 2:139018779-139018801 CAGCTGATGTGAAGCCCAGAGGG - Intergenic
939796703 2:146654594-146654616 CAGCTACTCTGGAGCTCAGGTGG + Intergenic
941200626 2:162504610-162504632 AATCTGATGTGGATCCCAGGAGG + Exonic
943092438 2:183390568-183390590 CAGCTGATATGGAGCCCAGATGG - Intergenic
943153125 2:184138781-184138803 CAGCTGGTGTGGAGCCCAGAGGG - Intergenic
943226415 2:185184950-185184972 CAGCTGAAGCTGTGCCCAGGAGG - Intergenic
943386315 2:187207793-187207815 CAGCTAAAGTAGAGCCCAGGGGG + Intergenic
943489591 2:188534047-188534069 CAGCTGCTGTGGAGAGCAGTTGG + Intronic
944696670 2:202207760-202207782 GAGCTGAGGTTGAGCCCAGGAGG - Intronic
948332063 2:237177559-237177581 AAGCTGTTGTTGAGCCCAGTGGG + Intergenic
1169161530 20:3383210-3383232 GAGATGATGAGGAGACCAGGTGG - Intronic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1171053515 20:21883568-21883590 CAGCTGATATGGAGCCCAGAGGG - Intergenic
1171231322 20:23488828-23488850 CACCTGATCTGGGCCCCAGGAGG - Intergenic
1171936591 20:31280085-31280107 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1172035828 20:32010309-32010331 CATCTGATGGGGAGGGCAGGGGG - Intergenic
1172404548 20:34677855-34677877 CAGCTACTCTGGAGCCCGGGAGG - Intergenic
1173389708 20:42621200-42621222 CAGGCGATCTAGAGCCCAGGGGG - Intronic
1173896529 20:46555240-46555262 AATCTGATGGGGAGACCAGGAGG - Intergenic
1174126656 20:48311585-48311607 CAGCCGATGGGGAGGCCAGAAGG + Intergenic
1174181414 20:48677237-48677259 CAGCAGCAGAGGAGCCCAGGAGG + Intronic
1175524403 20:59623719-59623741 CAGCGGATGTGGTGGCCATGTGG + Intronic
1176264734 20:64203236-64203258 CAGCTGCTGTGGAGGCCTGTGGG - Intronic
1176374119 21:6078700-6078722 CAGCTGATGTGCAGGGCCGGGGG + Intergenic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1176819507 21:13643283-13643305 CAGCTGATGTGGAGCCCGGAGGG + Intergenic
1176970226 21:15256315-15256337 CTGCTGAGGTGGAGCCCTAGAGG - Intergenic
1177125761 21:17191663-17191685 CAGCAACTGTGGAGCCCAAGGGG - Intergenic
1177356906 21:20019995-20020017 CAGCTGATATGGAGCCTTGAGGG - Intergenic
1178972251 21:37190522-37190544 CAGCTGAGGTTGAGACCAAGTGG + Intronic
1179730006 21:43362423-43362445 CAGCTGATGTGGGGGGTAGGGGG - Intergenic
1179749358 21:43459543-43459565 CAGCTGATGTGCAGGGCCGGGGG - Intergenic
1180076456 21:45465788-45465810 CACCTGATGCTGAGCACAGGCGG + Intronic
1180135843 21:45861250-45861272 CAGCAGATGTGAGGCCCAGGTGG - Intronic
1180364549 22:11926781-11926803 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1180477543 22:15724906-15724928 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
1181396929 22:22629516-22629538 CAGCTGATGAGGGGGCCGGGAGG - Intergenic
1181458141 22:23070908-23070930 CGGCTGATGCGGAGCCCGGGCGG + Intronic
1181499676 22:23308875-23308897 CAGCTGATGAGGGGGCCGGGAGG - Intronic
1181727640 22:24822575-24822597 GAGCTGATGTGGAGCAGAGAGGG + Intronic
1182004941 22:26952110-26952132 AATCTCATGTGGTGCCCAGGGGG - Intergenic
1183370275 22:37427960-37427982 CAGCGGAGGCGGAGTCCAGGGGG - Intergenic
1184138748 22:42565250-42565272 CAGCTGATCTGGCGGCTAGGCGG - Intronic
1184505734 22:44900881-44900903 CAGCTGATGTGTGCTCCAGGGGG - Intronic
949534307 3:4984007-4984029 CAGCTGATGTGTATCGAAGGGGG - Exonic
950923158 3:16715685-16715707 CAGCTGATGTGGAGCACAGGTGG - Intergenic
951258750 3:20482008-20482030 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
951822367 3:26827141-26827163 CAGCTGATGAGCAGCCCAGAGGG + Intergenic
952633146 3:35494094-35494116 AAGCTGAAATGGAGCCCAAGAGG + Intergenic
954138668 3:48594092-48594114 CTGGAGATGGGGAGCCCAGGAGG - Intronic
954522706 3:51243232-51243254 CAGATGATGTGGAGCCCAGGGGG - Intronic
954583504 3:51716259-51716281 CAGCTTGTGTGGATCCCAAGGGG + Intronic
955937200 3:64113181-64113203 CAGCTGATGTGTAGCCCAGAGGG + Intronic
958064792 3:88529175-88529197 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
958464589 3:94442520-94442542 CTACTGATGTGGAGCCCAGAGGG + Intergenic
958768767 3:98402015-98402037 CAGCTGAGGTGAAGCCCAGAGGG + Intergenic
959041062 3:101423937-101423959 CAGCTGATGTGGAGCCCAGAAGG + Intronic
959169728 3:102830374-102830396 CAGTTGATATGGAGCCCAGAGGG + Intergenic
959421520 3:106135363-106135385 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
961987972 3:131157922-131157944 CAGCTGATGTGAAGTCCAGAGGG + Intronic
962236488 3:133711658-133711680 GAGCGGATGTGGAGTTCAGGTGG - Intergenic
962335693 3:134527980-134528002 CAGCTGATATGGAGCCCAGAGGG - Intronic
962384476 3:134921841-134921863 CTGCAGATGAGGAGCACAGGTGG + Intronic
962486408 3:135847131-135847153 CAGCTGAACTGGATCCCAGGAGG - Intergenic
962655813 3:137542911-137542933 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
962836820 3:139196748-139196770 CAGCCGAGGTGGAGCCAAGACGG - Intronic
963914185 3:150842406-150842428 CAGCTGATGTGGAGACTAGAGGG - Intergenic
963984591 3:151577026-151577048 AAGCTGAGGTTCAGCCCAGGAGG - Intergenic
966320898 3:178699792-178699814 CAGCTGATGTGAAGCCCAGAGGG - Intronic
966714358 3:183000697-183000719 CAGCTGATGTGGAGCCCAAAAGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967523646 3:190466522-190466544 CAGCTGATATGGAGCCCAGAGGG + Intergenic
967888248 3:194347456-194347478 CAGCTGAGCTGGAGCCCAAATGG - Intronic
968431480 4:561647-561669 TGGCTGCTGTGGAGCTCAGGCGG - Intergenic
968503620 4:962130-962152 GAGCTGTTGGGGAGCTCAGGGGG - Intronic
968708009 4:2092377-2092399 CAGCTGCTGCTGAGCCCAGCAGG - Intronic
969221410 4:5761271-5761293 CAGGAGATGTTGAGCCCAGTGGG + Intronic
969424350 4:7115569-7115591 CAGGTGATGTGGAGGTGAGGAGG + Intergenic
970101131 4:12524115-12524137 CAGCTGATTTGGACCCCAGAGGG + Intergenic
971598801 4:28567341-28567363 CAGCCTGTGTGGAGCCCAGATGG + Intergenic
972830636 4:42810129-42810151 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
972835289 4:42862937-42862959 CAGATGCTGTGGAGCCCAGCAGG + Intergenic
973366116 4:49210906-49210928 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
973394481 4:49581530-49581552 CAGGTGATGTGGAGCCCAGAGGG + Intergenic
974199927 4:58623953-58623975 CAGCTGGTATGAAGCCCAGAAGG + Intergenic
975022182 4:69503025-69503047 CAGCTGATGTGAAGCCAAGAGGG + Intronic
975361672 4:73477605-73477627 CAGCTGATGTGTAGGCCAAAGGG - Intergenic
975403670 4:73965545-73965567 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
977211025 4:94218370-94218392 CAGCTACTCAGGAGCCCAGGAGG - Intronic
977554750 4:98477366-98477388 CAGCTGAGGTGGTCCCCTGGAGG + Intronic
979010080 4:115355778-115355800 CAGCTGATGTGCAGCCCAGGAGG - Intergenic
979158651 4:117429970-117429992 CAGCTGATGTGGATCCCAGAGGG - Intergenic
979200942 4:117977550-117977572 TAGCCCATGTGGAGCCCAGCTGG + Intergenic
980148261 4:129015609-129015631 CAGCTCATGTGGATCCCAGAGGG - Intronic
980257753 4:130403573-130403595 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
981454132 4:144933839-144933861 TAGTTGATGTGGAGCCCAGAGGG - Intergenic
981466231 4:145075798-145075820 CAGCCTGTGTGGAGCCCAGAGGG + Intronic
981511800 4:145566091-145566113 CAGCTGGTGCAGAGCCCAGAGGG + Intergenic
981849978 4:149218680-149218702 CAGCTGACATGGAGCCCAGAGGG + Intergenic
982629875 4:157819184-157819206 CAACAGATGTCGAGCCCAGAGGG + Intergenic
982646260 4:158027723-158027745 CAGATGATATGGAACCCAGAGGG + Intergenic
983420260 4:167507391-167507413 CACCTGATGTGGAGCCCAGAGGG - Intergenic
1202763633 4_GL000008v2_random:133402-133424 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
985767596 5:1788061-1788083 AAGCTGATGGGGACCCCTGGGGG - Intergenic
985969764 5:3365801-3365823 AAGCTACTGTGGAGCCCAGCGGG - Intergenic
986754707 5:10824329-10824351 CAGATGATGTGGGGCCCAGAGGG - Intergenic
987166491 5:15203521-15203543 CAGCTCATGTGTAGAGCAGGAGG - Intergenic
987366347 5:17152475-17152497 CAGTTGCTCTGGAGGCCAGGCGG - Intronic
987815470 5:22895498-22895520 CAACTGACTTGGAGCACAGGTGG - Intergenic
988069441 5:26267443-26267465 CACCTGCTCTGGAGCCCAGTAGG - Intergenic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
988252760 5:28781748-28781770 CAGATGGTGTGGCTCCCAGGTGG - Intergenic
988336340 5:29913599-29913621 CAGCTGATGTGGGGCCCAGAGGG + Intergenic
988507782 5:31838983-31839005 CAGATGATCTGGAGGGCAGGAGG - Intronic
988935484 5:36078520-36078542 CAGCTGCAGTGGCACCCAGGAGG + Intergenic
989693348 5:44171015-44171037 CAGCTGATGTGGACTCCAGAGGG + Intergenic
990134715 5:52631370-52631392 CAGCTTGTGTGGAGCTCAGAGGG - Intergenic
991577653 5:68122017-68122039 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
991978194 5:72203725-72203747 CTGCTGCTGAGGAGCCCAGCCGG + Exonic
992072963 5:73165543-73165565 GAGCTGAAATGGAACCCAGGTGG - Intergenic
993228834 5:85204958-85204980 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
993311371 5:86337587-86337609 CAGGTGATGTAGAGCCCACAGGG + Intergenic
994468359 5:100169215-100169237 AATCTGAAGTGGAGCACAGGAGG - Intergenic
994597616 5:101859982-101860004 CAGCTGATGTGAAGTTCAGAGGG + Intergenic
994970410 5:106730382-106730404 CAGCTAGTGTGGAGGCCAGAGGG + Intergenic
995187897 5:109290558-109290580 CAGCTGATGTGGAGCCCAAAGGG + Intergenic
995691329 5:114829544-114829566 CAGCTGATGTGGTGCCCAGAGGG + Intergenic
996495938 5:124156595-124156617 CCGCTGATGTCGATCCCTGGCGG - Intergenic
996663075 5:126027117-126027139 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
996954325 5:129164674-129164696 CAGCTGATGTGGAGCCCAGGGGG - Intergenic
998014518 5:138721770-138721792 CACCAGATGTGGATACCAGGAGG + Intronic
998276029 5:140753986-140754008 CAGCTGGTGCAGAGCCCAGAGGG - Intergenic
998368955 5:141649168-141649190 CGGCTGATGTCCAGGCCAGGTGG - Exonic
998756025 5:145380072-145380094 CAGCTGATGTAGAGCCCAGAGGG - Intergenic
999148483 5:149411244-149411266 CAGGTGATGAGGGGACCAGGCGG + Intergenic
1001034305 5:168286539-168286561 CAGCAGAGGCGGAGCCCTGGTGG - Intergenic
1002043618 5:176530540-176530562 CAGCTGCCCTGGAGCCCAGGTGG + Intronic
1003166480 6:3683478-3683500 CGCCTGATGTGTAGCCCACGAGG + Intergenic
1003696079 6:8407465-8407487 GAGCTGATGTTGATTCCAGGGGG - Intergenic
1006246955 6:32745877-32745899 CAGGTGATGTTGACCACAGGAGG - Exonic
1006397704 6:33797858-33797880 CTGCTGAAGTGGAGCCTTGGGGG - Intronic
1006613603 6:35310433-35310455 CAGCTGATTTGCAGCCCTGGTGG + Intronic
1007314939 6:40979594-40979616 CAGGTAGTGTGGAGCCCAGAGGG - Intergenic
1007524389 6:42479254-42479276 CAGCTAATGTGTAGCACAGTTGG + Intergenic
1007711276 6:43825851-43825873 CAGGTGGTGTGGAGCTCTGGGGG + Intergenic
1008332462 6:50260682-50260704 CAGCTGATGTGAAGACCAGAGGG - Intergenic
1009596743 6:65745860-65745882 CAACTGATGTGGAGCCCACAGGG + Intergenic
1009861335 6:69337471-69337493 CAGCTGATGTGCAGCCACTGTGG + Intronic
1010547186 6:77173021-77173043 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1011349247 6:86404326-86404348 CAGGTTATATGGAGCCCAGGTGG + Intergenic
1011704233 6:89985296-89985318 CAGCAGATGAGAATCCCAGGTGG - Intronic
1011792730 6:90915692-90915714 CAGCCGGTGTGGAGCCCTTGTGG + Intergenic
1012490818 6:99780632-99780654 CAGCCAATGTAGAGCCCAGAGGG - Intergenic
1012616478 6:101284432-101284454 CAGCTGATGTGGAGCCCAGTGGG + Intergenic
1014183347 6:118408363-118408385 CAGCTAATGTGGAGCCCAGAGGG + Intergenic
1016878956 6:148891236-148891258 CAGGTGAAGTGAAGCCAAGGAGG - Intronic
1017980658 6:159398393-159398415 GAGGAGATTTGGAGCCCAGGAGG + Intergenic
1019311679 7:364959-364981 CAGCTGATGTACAGCTCAGGAGG - Intergenic
1019998345 7:4739869-4739891 CAACTGCTGTGGCACCCAGGTGG - Intronic
1020277203 7:6631932-6631954 GAGCTCAGGAGGAGCCCAGGAGG + Intergenic
1021351233 7:19596150-19596172 CAGCTGATGTGGAGCCCAGAAGG - Intergenic
1021620352 7:22544977-22544999 CTGCTGTGGTAGAGCCCAGGTGG + Intronic
1021967291 7:25933007-25933029 CAGTCGATGTAGAGCCCAGAGGG + Intergenic
1022069398 7:26897546-26897568 CAACTAATGTGGAACCCAAGAGG - Intronic
1023219254 7:37901872-37901894 CAGCTGATGAGATACCCAGGAGG + Intronic
1023241327 7:38151078-38151100 CAGCTGATACGGAGCCCAGAGGG + Intergenic
1023805797 7:43872191-43872213 GAGGTGGTGTGGAACCCAGGGGG - Intronic
1025158953 7:56636373-56636395 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1025727648 7:64081857-64081879 CAGCTCATGTGGTACCCAGAGGG - Intronic
1025756772 7:64351719-64351741 CAGCTCATGTGGTGGCCAGAGGG - Exonic
1027053859 7:75036925-75036947 CAGTTGATGTGCATTCCAGGAGG - Intronic
1027627566 7:80564340-80564362 CAGCTCATGTTGTGCCCAGAGGG - Intronic
1028008821 7:85614589-85614611 CAGCTTATGTGGAGCCCAGAAGG + Intergenic
1028082972 7:86600398-86600420 CAGCTGATGTTGAGCCCAGAGGG + Intergenic
1028995700 7:97097671-97097693 CAGCTGCTCTGGAGCTGAGGTGG + Intergenic
1029809822 7:103036019-103036041 CTGATGAGGTGGAGCTCAGGAGG - Intronic
1029899181 7:104021937-104021959 CAGCTGCAGTTGTGCCCAGGAGG - Intergenic
1031247228 7:119329901-119329923 AGGCTGAGGTTGAGCCCAGGAGG + Intergenic
1031574691 7:123401009-123401031 CAGCTGAGGTAGACCCCAAGTGG + Intergenic
1032310344 7:130780397-130780419 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1032433303 7:131880347-131880369 AAGCTGGAGTGGAGCCCAGGAGG - Intergenic
1032999904 7:137492640-137492662 CAGCCAGTGTGGAGCCCAGAGGG + Intronic
1034257736 7:149733721-149733743 GAGCTGCAGTGGAGCCCAGGAGG - Exonic
1034366193 7:150550885-150550907 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1034512365 7:151546508-151546530 CAGGTGAAGAGGAGCACAGGCGG + Intergenic
1035007555 7:155678410-155678432 CACCTGAAGCTGAGCCCAGGAGG + Intronic
1035167683 7:157001129-157001151 CAGCTACTGCGGAGCCCAGGCGG - Intronic
1035327180 7:158072759-158072781 CAGCTGCTGTGTAGCCCTGTAGG + Intronic
1035684975 8:1517331-1517353 GAACGGATGTGGAGCCCAGGAGG + Intronic
1035717339 8:1764081-1764103 CAGCTGAGGGGGAACCCAGATGG + Intronic
1035777900 8:2203573-2203595 CAGGTGATGTGCTGTCCAGGTGG + Intergenic
1035847671 8:2882673-2882695 CTGCTGAGTGGGAGCCCAGGTGG + Intergenic
1037319793 8:17631725-17631747 CAGGTGAGGTGGAATCCAGGAGG - Intronic
1037373669 8:18206045-18206067 CAGCCGATGTGGAGCCCAGAGGG - Intronic
1037842706 8:22256552-22256574 CAGCTGGTGTGGAGATGAGGCGG + Intergenic
1038349809 8:26765531-26765553 CAGCTCCAGTGGAGCCCAGTTGG - Intronic
1038584468 8:28776780-28776802 CACCTAAAGTGGAGACCAGGTGG + Intronic
1039264355 8:35808691-35808713 CAACTAAGGTGGAGCCCAGATGG + Intergenic
1039594496 8:38779086-38779108 CAGCTAATCTTGAGCCCAGGAGG - Intronic
1040087898 8:43364897-43364919 CAGCTGATGCGGAGCCCAAAGGG + Intergenic
1040372241 8:46788416-46788438 CAGCTCATGTGGTGCCCAGAGGG - Intergenic
1040380615 8:46868432-46868454 CAGCTCATGTGGTGCCCAGAGGG + Intergenic
1040482694 8:47841221-47841243 CAGCCTATGTGGAGCCCAGCAGG + Intronic
1041022104 8:53648382-53648404 AAGCTGGTGTGGAGGCCAGGAGG - Intergenic
1041383836 8:57278978-57279000 CAGCTGCAGCTGAGCCCAGGCGG - Intergenic
1041404542 8:57483552-57483574 CAAATAATGTGGAGCCCAGAGGG + Intergenic
1042976820 8:74478717-74478739 CAGCTGGTGCGGAGCCCAGAGGG - Intronic
1043656483 8:82674204-82674226 CAACTGATGTGGAGCCCAGAGGG + Intergenic
1043698472 8:83251818-83251840 CAGCTGATATGGAGCCCAGAAGG - Intergenic
1044127283 8:88474192-88474214 CATCTGACGTGGAGCCCAGAGGG + Intergenic
1044313699 8:90726175-90726197 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1046895024 8:119463249-119463271 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1047253900 8:123201355-123201377 AGCCTGATGTGCAGCCCAGGAGG + Intronic
1048396612 8:134020075-134020097 CTGCTCTTCTGGAGCCCAGGTGG - Intergenic
1048813871 8:138312824-138312846 CAGTTGAAGTGGAGACCATGTGG + Intronic
1048869640 8:138786572-138786594 CAGCTGATGATGAGTCCAGCTGG - Intronic
1049047758 8:140166079-140166101 CAGGTGGTGTGGAGTCCAGCTGG + Intronic
1049049856 8:140185889-140185911 ATGCTGTTGTGGAGTCCAGGAGG + Intronic
1049128027 8:140810226-140810248 CAGCTGAGGTGGAGCCCAGAGGG + Intronic
1049848851 8:144820108-144820130 CAGCTGCTGTGGAAGGCAGGAGG + Intergenic
1050424761 9:5501807-5501829 CAGGTGATGTGGAGCCCAGTAGG + Intergenic
1051097010 9:13477637-13477659 CAGCCTATGTGGAGCCCAGAGGG - Intergenic
1051116325 9:13698154-13698176 CAGCTGATGTGTAGCCCAGAGGG - Intergenic
1051515988 9:17930902-17930924 CAGCTGAATGGAAGCCCAGGTGG + Intergenic
1051899659 9:22025094-22025116 CAGCTGATGTGGAGCCCAGAGGG - Intronic
1052268648 9:26603640-26603662 CAGCTGAACTGCAGCCCATGTGG - Intergenic
1052534116 9:29726352-29726374 CAGCTGATGTGGAGCCCAGAAGG + Intergenic
1053442301 9:38126495-38126517 CAGCTGATCTGAGGCCCAGTGGG - Intergenic
1056442013 9:86631091-86631113 CAGCTGATGGGGAGCAGAGCTGG - Intergenic
1056654954 9:88501601-88501623 CAGCTGCTGTGGAAAACAGGAGG + Intergenic
1056706474 9:88956251-88956273 CTGCTGAGGTGAAGCTCAGGTGG + Intergenic
1057108567 9:92445089-92445111 CAGCTGGTGTGGAGCCCAGAGGG - Intronic
1057160056 9:92882997-92883019 CATCTGTTGGGGAGCGCAGGAGG + Intergenic
1057805328 9:98215854-98215876 CAGCTGGTGGGGAGCTCAGATGG - Intronic
1060596981 9:124854295-124854317 CAGCTGCTGTGGAGGCTGGGTGG + Exonic
1060603525 9:124894484-124894506 CAGCTGCTTGGGAGCCCAGGAGG - Intronic
1061452452 9:130675734-130675756 CAGCAGATGGGGAGCCCTAGTGG + Intronic
1062206325 9:135339530-135339552 CAGCCTCTGTGGAGCCCTGGTGG - Intergenic
1203527851 Un_GL000213v1:106287-106309 CAGCTGATGTGGAGCCCGGAGGG - Intergenic
1203544387 Un_KI270743v1:118275-118297 CAGGTGATGTGGAGCCCAGAGGG - Intergenic
1186219070 X:7330121-7330143 CAGCTTATTTGGAGACCTGGAGG - Intronic
1186685724 X:11922729-11922751 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1187801367 X:23067433-23067455 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1188492997 X:30755821-30755843 CAGCTGGTGTGGAGCCCAGAGGG + Intergenic
1188852589 X:35150550-35150572 CAGCCAATGTGGAGCCCAGAGGG + Intergenic
1188991095 X:36822007-36822029 CAGCTACTCTGGAGCTCAGGAGG - Intergenic
1189678243 X:43486542-43486564 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1189891859 X:45610921-45610943 CAGCCTGTGTGGAGCCCAGAGGG - Intergenic
1190085704 X:47393648-47393670 CAGCTGGGTTGGAGCCCAGGAGG - Intronic
1190429656 X:50367062-50367084 CTGCGGAGGTGGAGCACAGGTGG + Exonic
1191137581 X:57082602-57082624 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1191155302 X:57266808-57266830 CAGATGATGTGGAGCCCAGGGGG + Intergenic
1191207973 X:57854028-57854050 CATCTGGTGCAGAGCCCAGGGGG - Intergenic
1191609945 X:63101772-63101794 CAGCTAATGTGGACCCTAGAGGG + Intergenic
1191743649 X:64463400-64463422 CAGCAGATATGGATCCCAGAGGG - Intergenic
1191933898 X:66405266-66405288 CAGCTAATGTGGAACCCAGAGGG - Intergenic
1192926475 X:75759619-75759641 CAGCTGATATGGAGCCCAGAGGG + Intergenic
1193514982 X:82452013-82452035 CAGCATGTGTGGAACCCAGGGGG + Intergenic
1193580711 X:83259740-83259762 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1193614121 X:83667217-83667239 TAGCTGATGTAGAGCCCAGAAGG - Intergenic
1193790319 X:85808700-85808722 CAGTTGAGGTGGAGCCCAGAGGG - Intergenic
1193823444 X:86194713-86194735 CAGCTGATGTGGAGCCCAGAGGG + Intronic
1193960029 X:87914260-87914282 CAGCTGATGTGGAGCCCAGAGGG + Intergenic
1194247983 X:91538315-91538337 CAGATGATATGGAGCCCAGAGGG + Intergenic
1194310623 X:92301452-92301474 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1194512656 X:94814649-94814671 CAGCTAGTTTGGAGCCCAGAGGG - Intergenic
1194549100 X:95274052-95274074 CCGCTGATGTGGAGCCCAGAGGG + Intergenic
1194781403 X:98029034-98029056 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1194917579 X:99723711-99723733 CAGCTGATGCAGAGCCGAGAGGG + Intergenic
1195548307 X:106138392-106138414 CAGTTGATGTGGAGCCCAGAGGG + Intergenic
1196444002 X:115736038-115736060 CAGCCGATGTTGAGCCCCAGGGG - Intergenic
1196468094 X:115993355-115993377 CAGCTGATGAGGAACCCAAATGG + Intergenic
1196478727 X:116121198-116121220 CAGCGGAGGTGGAGCCAAGATGG + Intergenic
1196586869 X:117440081-117440103 CAGCCTGTGTGGAGCCCAGAGGG + Intergenic
1196899249 X:120367004-120367026 CAACTGATGTTGAGCCCAGTGGG - Intronic
1197076901 X:122363922-122363944 CAGCTGATGTGGAGCCCAGAGGG - Intergenic
1197378797 X:125713545-125713567 CAGCTAATGTGGAGCCCAAAGGG + Intergenic
1198591790 X:138191162-138191184 AAGATGATGTGGAACCAAGGTGG - Intergenic
1198759063 X:140012097-140012119 CAGCCAGTGTGGAGCCCAGAGGG - Intergenic
1198779681 X:140221475-140221497 CAGCCAGTGTGGAGCCCAGAGGG + Intergenic
1198891695 X:141403656-141403678 CAGCCTATGCGGAGCCCAGAGGG - Intergenic
1199400094 X:147389273-147389295 CAGCCGGTGTGGAGCCCAGAGGG + Intergenic
1200077662 X:153559624-153559646 CTGGTGATGTGGACCCCATGAGG + Intronic
1200566998 Y:4779844-4779866 CAGATGATATGGAGCCCAGAGGG + Intergenic
1200618905 Y:5415738-5415760 CAGCCTATGTGGAGCCCAGAAGG - Intronic
1200853502 Y:7911025-7911047 CAGCTTATGTGGTGTCCAGTGGG + Intergenic
1202256638 Y:22928323-22928345 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202266180 Y:23021522-23021544 CAGCTTATGTGGTGTCCAGTGGG - Intergenic
1202409629 Y:24562076-24562098 CAGCTTATGTGGTGACCAGAGGG - Intergenic
1202419173 Y:24655265-24655287 CAGCTTATGTGGTGTCCAGTGGG - Intergenic
1202451613 Y:25014819-25014841 CAGCTTATGTGGTGTCCAGTGGG + Intergenic
1202461154 Y:25108001-25108023 CAGCTTATGTGGTGACCAGAGGG + Intergenic