ID: 1087871257

View in Genome Browser
Species Human (GRCh38)
Location 11:103295458-103295480
Sequence TCCCTAAGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 880
Summary {0: 1, 1: 20, 2: 38, 3: 46, 4: 775}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087871257_1087871261 8 Left 1087871257 11:103295458-103295480 CCAGCACTCCCTCAACTTAGGGA 0: 1
1: 20
2: 38
3: 46
4: 775
Right 1087871261 11:103295489-103295511 ACAAATTTTTCTTTCTCTTATGG 0: 1
1: 6
2: 11
3: 111
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087871257 Original CRISPR TCCCTAAGTTGAGGGAGTGC TGG (reversed) Intronic
900427529 1:2587334-2587356 TCCCTAAGCTCAGGGCGTTCGGG + Intronic
901064868 1:6489864-6489886 TCCTCAAGTTGAGGGAGCTCGGG - Intronic
901416684 1:9121377-9121399 TCCCTAAGTTCTGGGATTACAGG - Intronic
901557328 1:10041951-10041973 TCCCAAAGTTGTGGGATTACAGG + Intronic
901582837 1:10259756-10259778 TCCCAAAGTGCAGGGATTGCAGG + Intronic
901646826 1:10721271-10721293 TCCCTAAGATCAGGGGGTGGGGG - Intronic
901938748 1:12645800-12645822 TCCCAAAGTGTAGGGATTGCAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902734682 1:18392333-18392355 TCCCAAAGTGGAGGGATTACAGG - Intergenic
902806248 1:18863105-18863127 GACCTGAGTTGAGGGAGGGCAGG - Intronic
903040702 1:20527920-20527942 TCCCTAAGTAGCGGGATTACAGG - Intergenic
903414263 1:23170820-23170842 TCCCAAAGTGGTGGGATTGCAGG - Intronic
903429863 1:23287180-23287202 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
903531948 1:24037709-24037731 TCCCTAAGTTTTGGGATTACAGG + Intergenic
903985914 1:27228348-27228370 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
904344393 1:29858433-29858455 TGCCAAGGTTGAGGGTGTGCTGG + Intergenic
904889050 1:33764256-33764278 TGCCAGAGTTGAGGGAGTCCAGG - Intronic
904926628 1:34054461-34054483 TCCCAAAGTTCAGGGATTACAGG - Intronic
905858779 1:41332339-41332361 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
906351243 1:45061830-45061852 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
906482454 1:46208249-46208271 TCCCGAAGTTCTGGGATTGCAGG + Intronic
906570487 1:46833932-46833954 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
906876613 1:49545894-49545916 TCCATAAGTTATGGGAGTACAGG + Intronic
907037831 1:51232315-51232337 TCCCAAAGTTCAGGGATTTCAGG - Intergenic
907079147 1:51605330-51605352 TCCCTAAGTGCTGGGATTGCAGG - Intronic
908233895 1:62132104-62132126 TCCCAAAGTTCTGGGAGTACAGG + Intronic
908256208 1:62305567-62305589 TCCCAAAGTTCAGGGATTACAGG + Intronic
908307550 1:62838517-62838539 TCCCAAAGTGGAGGGATTACAGG - Intronic
908320128 1:62970852-62970874 TCCCAAAGTGGAGGGATTACAGG - Intergenic
908728025 1:67197684-67197706 TCCCAAAGTTCAGGGATTACAGG - Intronic
909009521 1:70318937-70318959 TCCCAAAGTTCTGGGATTGCAGG + Intronic
909089644 1:71209230-71209252 CCCTGAAGGTGAGGGAGTGCAGG - Intergenic
909146785 1:71944418-71944440 TCCCTAAATTGAGGGAATAAAGG + Intronic
909635433 1:77812053-77812075 TCCCTAAGTTATGGGATTACAGG - Intronic
909646421 1:77922024-77922046 TCCCAAAGTTGGGGGAATACAGG + Intronic
909791202 1:79680303-79680325 TCCCAAAGTGTTGGGAGTGCAGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910775754 1:90872939-90872961 TCCCTAAGTGGTAGGAGTACAGG + Intergenic
911221722 1:95254342-95254364 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
911349299 1:96733418-96733440 TCCCTAAGTTCTGGGATTACAGG - Intronic
911762275 1:101630130-101630152 TCCCTGAGTTCAGGGAATACAGG + Intergenic
911954002 1:104213002-104213024 ACCCTAAGTTTAGGGAATCCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912914476 1:113799299-113799321 TCCCTAAGTTCTGGGATTACAGG + Intronic
913082403 1:115400767-115400789 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
914048617 1:144113298-144113320 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
914130567 1:144852150-144852172 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915542554 1:156577424-156577446 TCCCAAAGTTGTGGGATTACAGG + Intergenic
915618948 1:157067030-157067052 TCCCAAAGTACAGGGATTGCAGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915808571 1:158880877-158880899 TACCTCAGTTGAGGAAGTGTTGG - Intergenic
915813321 1:158939228-158939250 TACCTCAGTTGAGGAAGTGTTGG - Exonic
915966236 1:160311180-160311202 TCCCAAAGTTCTGGGATTGCAGG - Intronic
916125911 1:161571092-161571114 TCCTAAAGTTGGGGTAGTGCAGG - Intergenic
916135827 1:161652941-161652963 TCCTAAAGTTGGGGTAGTGCAGG - Intronic
916310129 1:163388850-163388872 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916656667 1:166882784-166882806 TCCCTAAGTGGTGGGATTACAGG + Intergenic
916809267 1:168291331-168291353 CCCCAAAGTTGGGGGAGTCCGGG - Exonic
916875605 1:168965112-168965134 TCCCTAAGTTTTGGGATTACAGG - Intergenic
917943295 1:179944848-179944870 TCCCAAAGTTGTGGGATTACAGG + Intergenic
919314277 1:195951667-195951689 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
919330817 1:196168626-196168648 TCCCAAAGTAGAAGGTGTGCAGG + Intergenic
919523097 1:198613602-198613624 TCCCTAAGTTCTGGGATTACAGG + Intergenic
919663227 1:200268400-200268422 TCCCAAAGTTGTGGGATTACAGG - Intergenic
920513948 1:206570350-206570372 TCCCTAAGTTCTGGGATTACAGG + Intronic
921076753 1:211706144-211706166 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
921290590 1:213653198-213653220 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
921452699 1:215327806-215327828 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
921832806 1:219747079-219747101 TCCCTAAGTTTTGGGATTACAGG - Intronic
922943918 1:229493872-229493894 TCCCAAAGTAGTGGGATTGCAGG - Intronic
923643810 1:235794089-235794111 TCCCAAAGTTCAGGGATTACAGG + Intronic
923680758 1:236116659-236116681 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
924044690 1:240015439-240015461 TCCCAAAGTGCAGGGAGTTCAGG - Intronic
924106201 1:240651680-240651702 TCCCAAAGTTCTGGGACTGCAGG - Intergenic
924127240 1:240867740-240867762 TCCCAAAGTTCTGGGATTGCAGG - Intronic
924314215 1:242778924-242778946 TCCCGAAGTGGAGGGATTACAGG - Intergenic
924733787 1:246736441-246736463 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
1064055858 10:12096606-12096628 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1064079912 10:12300031-12300053 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1064764612 10:18658742-18658764 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1065105372 10:22378320-22378342 TCCCTAAGTTCTGGGATTACAGG + Intronic
1065262904 10:23944164-23944186 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1065495700 10:26325438-26325460 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1065728967 10:28693303-28693325 TCCCTAAGTCCTGGGATTGCAGG - Intergenic
1065754311 10:28917067-28917089 TCCCAAAGTGTAGGGATTGCAGG - Intergenic
1065936313 10:30523458-30523480 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
1066193761 10:33079122-33079144 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1066458134 10:35589471-35589493 TCCCTAAGTGTTGGGATTGCAGG + Intergenic
1066631167 10:37460621-37460643 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1068236102 10:54234427-54234449 TCCCTAAGTTCTGGGATTACAGG - Intronic
1068308126 10:55241679-55241701 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1068441210 10:57057166-57057188 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1068454139 10:57233681-57233703 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1069010327 10:63364743-63364765 TCCCTAAGTGCTGGGAGTACAGG + Intronic
1069509511 10:69031253-69031275 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1069557989 10:69410256-69410278 TCCCAAAGTTTAGGGATTACAGG - Intronic
1070011121 10:72475685-72475707 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1070024263 10:72616873-72616895 TCCCTTAATTGAGGGAGTCTGGG - Intronic
1070024924 10:72623481-72623503 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1070230424 10:74560175-74560197 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1070255741 10:74811938-74811960 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1071548926 10:86551154-86551176 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1071576052 10:86727278-86727300 TCCCCAAGTTGTGGGAATACAGG + Intronic
1071701964 10:87948679-87948701 TCCCAAAGTTAAGGGATTACAGG - Intronic
1072154268 10:92709735-92709757 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1072154495 10:92712123-92712145 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1072387564 10:94946856-94946878 TCCCAAAGTTGTGGGATTACAGG - Intronic
1072548587 10:96459368-96459390 TCCCTAAGTTCTGGGATTACAGG - Intronic
1072585339 10:96776691-96776713 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1073334410 10:102694975-102694997 TCCCAAAGTGTTGGGAGTGCGGG + Intronic
1074323321 10:112423453-112423475 TCCCAAAGTTCTGGGATTGCTGG + Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074470421 10:113721809-113721831 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1074529475 10:114287437-114287459 TCCCAAAGTGGAGGGATTACAGG + Intronic
1074874940 10:117606428-117606450 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1074998000 10:118774285-118774307 TCCCAAAGTTTAGGGATTACAGG + Intergenic
1075026700 10:118990169-118990191 TCCCAAAGTTGCGGGATTGCAGG + Intergenic
1075683072 10:124346064-124346086 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1075982993 10:126757257-126757279 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1076836001 10:133021220-133021242 GCCCTGGGTTGAGGGAGGGCTGG + Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079221481 11:18565568-18565590 TCCCAAAGTTCAGGGATTACAGG - Intronic
1079742259 11:24077371-24077393 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1079861569 11:25678808-25678830 TCCCAAAGTTCTGGGACTGCAGG + Intergenic
1080543087 11:33288192-33288214 TCCCTAAGTGCAGGGATTACAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081913462 11:46715963-46715985 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1081926102 11:46830181-46830203 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083001956 11:59300694-59300716 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1083357932 11:62081328-62081350 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1083421998 11:62558889-62558911 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1084307349 11:68295711-68295733 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1084905663 11:72344468-72344490 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1085676678 11:78527119-78527141 TCCCAAAGTTTAGGGTGTGTTGG + Intronic
1086737674 11:90327078-90327100 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087382453 11:97423989-97424011 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1087734829 11:101820242-101820264 TCCCAAAGTTCAGGGATTACAGG - Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088273484 11:108059618-108059640 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1088595268 11:111436365-111436387 TCCCAAAGTGCTGGGAGTGCTGG - Intronic
1089804215 11:121068623-121068645 TCCCTAAGTGGTGGGATTACAGG - Intronic
1090780128 11:130000846-130000868 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1090938790 11:131369513-131369535 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1092004511 12:5057886-5057908 TCCCAAAGCTGTGGGATTGCAGG - Intergenic
1092342454 12:7688384-7688406 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1092611839 12:10181063-10181085 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1092618382 12:10236288-10236310 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1092795327 12:12105639-12105661 TCCCAAAGTTGGGGGATTACAGG - Intronic
1092983746 12:13824594-13824616 TCCCAAAGTGGAGGGATTACAGG - Intronic
1093318233 12:17678585-17678607 TCCCAAAGTTCTGGGACTGCAGG - Intergenic
1093722458 12:22460835-22460857 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1093881616 12:24410254-24410276 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1094070960 12:26412418-26412440 ATCCTGAGTTGAGGGTGTGCGGG + Intronic
1094144269 12:27212524-27212546 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1094737167 12:33247856-33247878 TACCTAAATTCTGGGAGTGCAGG + Intergenic
1095267258 12:40174835-40174857 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1095581151 12:43801008-43801030 TCCCAAAGTTTAGGGATTACAGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096349095 12:50879707-50879729 TCCCAAAGTTTAGGGATTACAGG - Intronic
1096924106 12:55123110-55123132 TCCCTAAGTTCAGGCAGTGATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097204481 12:57308424-57308446 TCCCTAAGTGTTGGGATTGCAGG - Intronic
1097205821 12:57320005-57320027 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1097511630 12:60549728-60549750 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1097542832 12:60961716-60961738 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1097773591 12:63619761-63619783 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1098531824 12:71550389-71550411 TCCCTAAGTTCTGGGATTACAGG + Intronic
1098544144 12:71692934-71692956 TCCCTAAGTTTTGGGATTACAGG - Intronic
1098689106 12:73464858-73464880 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1098987643 12:77029816-77029838 TGCCCAAGGTAAGGGAGTGCAGG - Exonic
1099264608 12:80429712-80429734 TCCCAAAGTGTAGGGATTGCAGG - Intronic
1100161921 12:91870767-91870789 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1100169603 12:91959370-91959392 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1100639066 12:96463762-96463784 TCCCAAAGTTCTGGGACTGCAGG + Intergenic
1102249265 12:111374930-111374952 TCCCAAAGTTCTGGGATTGCTGG - Intergenic
1102342072 12:112129458-112129480 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1102787583 12:115617162-115617184 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103380848 12:120493277-120493299 TCCCTAAGTTTTGGGATTACAGG - Intronic
1103514289 12:121496934-121496956 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1103548574 12:121719500-121719522 TACCTAAGTTCAGGAAGTGGAGG + Intronic
1103744124 12:123110707-123110729 TTCCTAAGTAGAAGGGGTGCCGG - Intronic
1103879505 12:124155195-124155217 TCCCAAAGTTGTGGGATTACAGG - Intronic
1104855224 12:131898753-131898775 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1105740739 13:23320557-23320579 ATGCTAAGTTGAGGGATTGCTGG + Intronic
1105882960 13:24619702-24619724 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1106103494 13:26714358-26714380 TCCCTAAGGTTGGGGAGTGAGGG + Intergenic
1106543638 13:30712654-30712676 TCCCTAAGTGGTGGGACTACAGG + Intergenic
1106685557 13:32055299-32055321 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1106733828 13:32569194-32569216 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1107845161 13:44505168-44505190 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109308539 13:60665376-60665398 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109735068 13:66472309-66472331 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1113193365 13:107776830-107776852 TCCCAAAGTTTTGGGATTGCAGG - Intronic
1113772391 13:112918437-112918459 TCGGCAAGTTGAGGGTGTGCAGG + Intronic
1113846134 13:113392867-113392889 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1114602049 14:23964833-23964855 TCCCGAAGTGCAGGGATTGCAGG + Intronic
1114606221 14:23999951-23999973 TCCCGAAGTGCAGGGATTGCAGG + Intronic
1115203805 14:30879919-30879941 TCCCAAAGTTCAGGGATTACAGG + Intronic
1115531074 14:34327727-34327749 TCCCAAAGTTCAGGGATTACAGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116730337 14:48613008-48613030 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1116904137 14:50388839-50388861 TCCCTAAGTACAGGGATTACAGG - Intronic
1116907381 14:50417291-50417313 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1117153612 14:52914659-52914681 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1117222249 14:53617710-53617732 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1117377225 14:55128001-55128023 TCCCTAAGTTGAAAAACTGCAGG + Intronic
1117665596 14:58052914-58052936 TCCCTGAGATGAGAGAGAGCAGG - Intronic
1118989420 14:70784482-70784504 TCCCAAAGTTGTGGGATTACAGG - Intronic
1119041812 14:71281257-71281279 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1119487997 14:75004430-75004452 TCCCAAAGTTGTGGGATTACAGG - Intronic
1119549898 14:75501265-75501287 TCCCCAACTTTGGGGAGTGCTGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120340016 14:83207852-83207874 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1120789301 14:88564059-88564081 TCCCTAGGTGCTGGGAGTGCGGG + Intronic
1121036888 14:90713372-90713394 TCCCAAAGTTCAGGGATTACAGG + Intronic
1121058868 14:90884992-90885014 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1121198619 14:92097781-92097803 TCCCTAAGTTCTGGGATTACAGG + Intronic
1121871851 14:97415338-97415360 ACACTAAGTTTAGGGAGTGTGGG - Intergenic
1122341815 14:101033504-101033526 TCCCGAAGTAGAGGGAGTCTGGG + Intergenic
1122537535 14:102476271-102476293 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123418553 15:20112907-20112929 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1123527771 15:21119447-21119469 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1124097231 15:26659971-26659993 TCCCAAAGTTCTGGGATTGCGGG - Intronic
1124111348 15:26791914-26791936 TCCCGAAGTTGTGGGATTACAGG + Intronic
1124166645 15:27332255-27332277 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1124422534 15:29535423-29535445 TCCCAAAGTTGTGGGATTACAGG - Intronic
1124546127 15:30628337-30628359 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1125103727 15:35946535-35946557 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1125460764 15:39904717-39904739 CCCATAAGTTCGGGGAGTGCAGG - Intronic
1125603678 15:40928551-40928573 TCCCTGAGGTGGGGGAGGGCGGG - Intergenic
1125736599 15:41931251-41931273 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1125812515 15:42553563-42553585 TCCCTAAGTGCAGGGATTACAGG + Intronic
1125961129 15:43830786-43830808 TCCCAAAGTGCCGGGAGTGCAGG - Intronic
1126081583 15:44968477-44968499 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1126101831 15:45122646-45122668 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1126459034 15:48895822-48895844 TCCCTAAGTGGTGGGATTACAGG - Intronic
1126611060 15:50530046-50530068 TCCCAAAGTTGTGGGATTACAGG - Intronic
1128596755 15:68959166-68959188 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1128948789 15:71852619-71852641 TCCCAAAGTGGAGGGATTACAGG + Intronic
1129018260 15:72488982-72489004 TCCCAAAGTTGTGGGATTGCAGG - Intronic
1129124678 15:73428663-73428685 TCCCAAAGTTGAGGGATTACAGG + Intergenic
1129547884 15:76417759-76417781 TCCCAAAGTTGTGGGATTACAGG - Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130012814 15:80165268-80165290 TCCCAAAGTTGTGGGATTACAGG - Intronic
1130093952 15:80842471-80842493 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1130169730 15:81498842-81498864 TCCCTAAGGTGTGGGACAGCAGG - Intergenic
1130550154 15:84885215-84885237 TCCCAAAGTGCTGGGAGTGCAGG + Intronic
1130923480 15:88368073-88368095 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1131053930 15:89364663-89364685 TTGGTGAGTTGAGGGAGTGCAGG + Intergenic
1131278722 15:91003963-91003985 TCCCTAAGTTCTGGGATTACAGG - Intronic
1132143201 15:99411317-99411339 ACCCTAAGTCGAAGGAGTACAGG + Intergenic
1132697371 16:1207940-1207962 TCCCTAGGTTGGGGGATTCCTGG + Intronic
1133208854 16:4251437-4251459 TCCCAAAGTTGTGGGATTGCAGG - Intergenic
1133527153 16:6616691-6616713 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1133803707 16:9106542-9106564 CCCCTAAGTGGTGGGATTGCAGG + Intronic
1133925084 16:10185720-10185742 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1134476691 16:14580226-14580248 TCCCAAAGTTGGGGGATTACAGG + Intronic
1134586537 16:15416485-15416507 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1134908660 16:18004431-18004453 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1135034232 16:19063292-19063314 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1135651682 16:24211816-24211838 TCCCAAAGTTCAGGGATTACAGG + Intronic
1135740539 16:24971584-24971606 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1135932677 16:26751864-26751886 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1136177292 16:28526180-28526202 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1136448882 16:30341045-30341067 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1136536540 16:30902933-30902955 TCCCTAAGTGCTGGGATTGCAGG + Exonic
1136623899 16:31449731-31449753 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1137401724 16:48158895-48158917 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1137526663 16:49242247-49242269 GCCCTGAGTTGGGGAAGTGCTGG - Intergenic
1137635154 16:49979676-49979698 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1137741797 16:50783795-50783817 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1138099694 16:54242700-54242722 TCCAAAAGTTCAGGGATTGCAGG - Intergenic
1138219797 16:55240971-55240993 TCTCTAAGTTGAGGTCCTGCTGG + Intergenic
1138437066 16:57008127-57008149 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1138684723 16:58715083-58715105 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1138974080 16:62182209-62182231 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1139043460 16:63028980-63029002 TCCCTTAGTGGAAGGAATGCTGG - Intergenic
1139444936 16:66991848-66991870 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1139613807 16:68076996-68077018 TCCCAAAGTTGTGGGATTACAGG - Intronic
1139716349 16:68816485-68816507 TCCCTAAGTTTTGGGATTACAGG - Intronic
1139786323 16:69395478-69395500 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1139841289 16:69882892-69882914 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1139900417 16:70323680-70323702 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1140126717 16:72124267-72124289 TCCCAAAGTGTAGGGACTGCAGG + Intronic
1141237039 16:82228434-82228456 TCCCAAAGTTTTGGGATTGCAGG + Intergenic
1141386392 16:83625744-83625766 TCCCTAATTTCAGGGGGTGGGGG - Intronic
1141507861 16:84491179-84491201 TCCCAAAGTGGAGGGATTACAGG - Intronic
1142524042 17:525737-525759 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1142779019 17:2165951-2165973 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1142838648 17:2609266-2609288 TGCCAAAGTTGTGGGATTGCAGG + Intronic
1142862057 17:2768431-2768453 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1142870717 17:2818584-2818606 TCCCAAAGTTTTGGGATTGCAGG + Intronic
1143892217 17:10111274-10111296 TCCCAAAGTTGTGGGATTACAGG - Intronic
1144597076 17:16579177-16579199 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1144758867 17:17695778-17695800 TCCCTAAGTACTGGGATTGCAGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146103104 17:30004891-30004913 TCCCAAAGTTGTGGGATTACAGG + Intronic
1146559309 17:33854567-33854589 TCCCTACTTTGAGGGAATCCTGG - Intronic
1146602751 17:34232950-34232972 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1146785840 17:35720678-35720700 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1147184510 17:38705956-38705978 ACCCTAAGTTGAGGGAGTTTGGG + Intronic
1147289215 17:39428224-39428246 TCCCAAAGTTGTGGGATTACAGG - Intronic
1148116224 17:45176793-45176815 TCCCAAAGTTAAGGGAGGGAGGG - Intergenic
1148158883 17:45438813-45438835 TCCCAAAGTTGTGGGATTACAGG + Intronic
1148184705 17:45633746-45633768 TCCCAAAGTGTAGGGAGTACAGG - Intergenic
1148234536 17:45959547-45959569 TCCCAAAGTTTAGGGATTACAGG - Intronic
1149319199 17:55467652-55467674 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1149429392 17:56585216-56585238 TACCTAAGTTGAGGGTTTGGAGG - Intergenic
1149603353 17:57907585-57907607 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1150097030 17:62385983-62386005 TCCCTAAGTGCAGGGATTACAGG + Intronic
1150279567 17:63921312-63921334 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1150351287 17:64446837-64446859 TCCCGAAGTTGTGGGATTACAGG - Intergenic
1150585408 17:66512949-66512971 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1150814457 17:68381880-68381902 TCCCTAGGTTTAGTGAGTGAGGG + Intronic
1150843766 17:68634244-68634266 TCCCAAAGTTGTGGGACTACTGG + Intergenic
1150984261 17:70177545-70177567 TCCCTAAGGTGAAGGTGGGCTGG - Exonic
1151635544 17:75345300-75345322 TCCCAAAGTTGTGGGATTACAGG + Intronic
1151748952 17:76026200-76026222 TCCCAAAGTTGTAGGATTGCAGG + Intronic
1151784334 17:76267915-76267937 TCCCAAAGTTCAGGGATTACAGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1151948255 17:77331094-77331116 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1152104602 17:78321597-78321619 TCCCGAAGTTCTGGGATTGCAGG + Intergenic
1152417949 17:80175234-80175256 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153130600 18:1851628-1851650 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
1153197116 18:2612545-2612567 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1153243165 18:3049180-3049202 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1153508762 18:5830683-5830705 TCCCAAAGTTCTGGGACTGCAGG - Intergenic
1154137266 18:11790913-11790935 TCCCTAAGTTCTGGGATTACAGG + Intronic
1154965735 18:21354327-21354349 TCCCTAAGTGTTGGGACTGCAGG - Intronic
1155188061 18:23404727-23404749 TCCCAAAGTGCTGGGAGTGCTGG - Intronic
1155222312 18:23696756-23696778 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1155449760 18:25951460-25951482 TCCATAAATTCTGGGAGTGCAGG - Intergenic
1155532607 18:26782358-26782380 TTCCAAGGTTGAGGGAGTTCAGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156266666 18:35495168-35495190 TCCCAAAGTTTAGGGATTACAGG - Intronic
1157222331 18:45837284-45837306 CTCCCAAGTCGAGGGAGTGCAGG + Intronic
1157776149 18:50397779-50397801 TCCCTAAGTTGTGGCAGGCCAGG - Intergenic
1158349194 18:56547725-56547747 TCCCAAAGTTCTGGGATTGCGGG - Intergenic
1158455242 18:57600326-57600348 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1158717136 18:59890432-59890454 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159402811 18:67959529-67959551 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1159650695 18:70974131-70974153 TCCCTAAGATTAGGGAGCCCAGG + Intergenic
1159692765 18:71510553-71510575 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
1160784784 19:894823-894845 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1160850898 19:1191717-1191739 TCCCAAAGTTGTGGGACTACAGG + Intronic
1161024530 19:2029856-2029878 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1161157080 19:2737938-2737960 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1161197008 19:2992510-2992532 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1161234661 19:3191928-3191950 TCCCAAAGTTCAGGGATTTCAGG - Intronic
1161646842 19:5458256-5458278 TCCCGAAGTGCTGGGAGTGCAGG - Intergenic
1161818601 19:6515675-6515697 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1162150126 19:8639100-8639122 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1162209824 19:9082377-9082399 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1162369546 19:10270598-10270620 TCCCTCAGTGGAGGGAGCCCGGG + Intergenic
1162559542 19:11408221-11408243 TCCCAAAGTTTTGGGATTGCGGG + Intronic
1162612237 19:11765785-11765807 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1162703164 19:12534553-12534575 TCCCAAAGTTGTGGGATTACAGG - Intronic
1162882223 19:13668225-13668247 TCCCTAAGTACTGGGATTGCAGG + Intergenic
1163121100 19:15218411-15218433 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1163259718 19:16181315-16181337 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163434963 19:17289938-17289960 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1163573359 19:18096574-18096596 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1163706648 19:18818110-18818132 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1163802618 19:19375992-19376014 TCCCAAAGTGGAGGGATTACAGG + Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164541723 19:29126516-29126538 TCCCCAAGATGAGGAAGTGTCGG + Intergenic
1164742301 19:30584835-30584857 TCCCAAAGTGCAGGGATTGCAGG - Intronic
1165357485 19:35312777-35312799 TCCCAAAGTTGTGGGATTACAGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165705231 19:37971237-37971259 TCCCTAAGTGCTGGGAGTGCAGG + Intronic
1165803516 19:38566904-38566926 TCCCTAGGTGGATGGAGTGGAGG + Exonic
1165881206 19:39045308-39045330 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1165959620 19:39523208-39523230 TCCCAAATTTGTGTGAGTGCAGG - Intergenic
1166185243 19:41135259-41135281 TCCCTGAGATGCGGGAGTCCAGG - Intergenic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1166551000 19:43666019-43666041 TCACTAAGCTGAGGGTGTGGGGG - Intronic
1167111801 19:47466806-47466828 TCCCAAAGTTCAGGGATTACAGG - Intronic
1167126753 19:47554833-47554855 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1167254493 19:48419135-48419157 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1167280080 19:48561989-48562011 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1167341657 19:48920025-48920047 TCCCTAAGTGGTGGGATTACAGG + Intronic
1167385860 19:49163018-49163040 TCCCTAAGTTCTGGGATTACAGG + Intronic
1167440159 19:49503700-49503722 TCCCTAAGTAGTGGGATTACAGG - Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1168282944 19:55315371-55315393 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1168329852 19:55561387-55561409 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1168356300 19:55702217-55702239 TCCCAAAGTAGTGGGATTGCAGG + Intronic
1202688070 1_KI270712v1_random:66201-66223 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
925125495 2:1452847-1452869 CCCCTAAGTTGAAGGGGTGTAGG - Intronic
925400094 2:3566443-3566465 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
925912483 2:8582841-8582863 TCCCTAAGCCGAGGCAGCGCTGG - Intergenic
926738537 2:16092541-16092563 TCCCAAAGTTCAGGGATTACAGG + Intergenic
926833091 2:16986589-16986611 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
926989355 2:18660880-18660902 TCCCAAAGTTGTGGGATTACAGG - Intergenic
927017740 2:18984007-18984029 TCCCAAAGTTCAGGGATTACAGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927320943 2:21745003-21745025 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
927689690 2:25199447-25199469 TCCCTAAGTTCTGGGATTACAGG - Intergenic
927788526 2:25991426-25991448 TCCCTAAGTGGTGGGATTACAGG - Intergenic
927977198 2:27347873-27347895 TCCCTAAGTGCAGGGATTACAGG - Intronic
928520949 2:32088144-32088166 TCCCAAAGTGGTGGGAGTACAGG + Intronic
929205672 2:39289824-39289846 TCCCAAAGTTGTGGGATTACAGG - Intronic
929215530 2:39407832-39407854 TCCCAAAGTGCTGGGAGTGCAGG + Intronic
930016947 2:46977240-46977262 TATCTAAGTTGAGGGAGGGCAGG + Intronic
930055844 2:47251338-47251360 TCCCAAAGTGGTGGGAGTACAGG + Intergenic
930086500 2:47501348-47501370 TCCCAAAGTGCAGGGAGTACAGG + Intronic
930768105 2:55105486-55105508 TCCCAAAGTTGTGGGATTACAGG + Intronic
930991698 2:57663912-57663934 TCCCAAAGTTGTGGGATTACAGG - Intergenic
931709060 2:64971996-64972018 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
931873050 2:66482116-66482138 TCCCAAAGTGGTGGGATTGCAGG + Intronic
932057155 2:68457371-68457393 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
932687729 2:73887389-73887411 TCCCAAAGTTCAGGGATTACAGG - Intergenic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933314909 2:80704293-80704315 TCCCAAAGTAGAGGGATTCCAGG - Intergenic
933488832 2:82958798-82958820 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933958284 2:87389393-87389415 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
934242410 2:90281310-90281332 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
934270764 2:91535373-91535395 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
934566072 2:95342103-95342125 ACCCTGAGATGAGAGAGTGCTGG + Intronic
935171080 2:100611971-100611993 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
935762484 2:106334238-106334260 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
936375731 2:111939760-111939782 TCCCAAAGTACTGGGAGTGCAGG + Intronic
937607181 2:123815156-123815178 TCCCAAAGTTCTGGGAGTGCTGG - Intergenic
938006815 2:127793874-127793896 TCCCAAAGTTCAGGGATTACAGG - Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938485860 2:131707310-131707332 TCCCTAAGTGGTGGGATTACAGG + Intergenic
938522981 2:132091671-132091693 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
942387102 2:175454009-175454031 TCCCAAAGTGGTGGGATTGCTGG - Intergenic
942644281 2:178094268-178094290 TCCCTAAGTGCTGGGATTGCAGG - Intronic
943114662 2:183652488-183652510 TCTCTAAATGGTGGGAGTGCAGG + Intergenic
943563144 2:189487156-189487178 TCCCAAAGTTCTGGGACTGCAGG + Intergenic
943621683 2:190155254-190155276 TGCCTAAGTTAAGGGAGGGTAGG + Intronic
943831638 2:192471671-192471693 TCCTTCAGGTGAGTGAGTGCTGG - Intergenic
943855339 2:192783190-192783212 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
943860656 2:192858094-192858116 TCCCAAAGTGCTGGGAGTGCTGG - Intergenic
944559679 2:200923506-200923528 TCCCAAAGTGAAGGGATTGCAGG + Intronic
944620252 2:201506809-201506831 TCCCAAAGTTTAGGGATTACAGG + Intronic
945253464 2:207784172-207784194 TCTCTAAGTTGGGGGATTACAGG - Intergenic
945813660 2:214577460-214577482 TCCCTAAGGAGTGGGAGTGAGGG + Exonic
946567954 2:220988381-220988403 TCCCTAAGTTCTGGGATTACAGG - Intergenic
947423118 2:229958525-229958547 TCCCTAAGTGGTGGGATTACAGG + Intronic
947567942 2:231207264-231207286 TCCCAAAGTTGTGGGATTGCAGG + Intronic
947894253 2:233654831-233654853 TCCCTAAGTGCAGGGATTACAGG - Intronic
947929129 2:233948772-233948794 TCCCAAAGTGCAGGGATTGCAGG - Intronic
948452849 2:238088201-238088223 TCCCAAAGTTCTGGGATTGCAGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169055946 20:2621102-2621124 TCCCAAAGTTGTGGGATTACAGG - Intronic
1169111876 20:3039494-3039516 TGCCTAACTACAGGGAGTGCTGG + Intergenic
1169183085 20:3588104-3588126 TCCCTAAGTTCTGGGATTACAGG + Intronic
1169428372 20:5513548-5513570 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1169925878 20:10783389-10783411 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
1170307382 20:14953561-14953583 TCCCAAAGTTCAGGGATTACAGG + Intronic
1170463412 20:16600135-16600157 TCCCAAAGTTATGGGATTGCAGG + Intergenic
1170638391 20:18129433-18129455 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1170686040 20:18570417-18570439 TCCCAAAGTGCAGGGAGTACAGG - Intronic
1170937061 20:20819681-20819703 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1171065317 20:22009360-22009382 TCCCAAAGTTGTAGGAGTACAGG + Intergenic
1171981893 20:31634301-31634323 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1172049313 20:32104382-32104404 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1172099878 20:32478838-32478860 TCCCAAAGTGCTGGGAGTGCGGG + Intronic
1172260948 20:33564836-33564858 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1172476955 20:35246194-35246216 TCCCAAAGTTGTGGGATTACAGG - Intronic
1172538345 20:35691790-35691812 TCCCAAAGTGGAGGGATTACAGG - Intronic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173708131 20:45129187-45129209 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1174015992 20:47488698-47488720 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1174938312 20:54896357-54896379 TCCATAAGTTATTGGAGTGCAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175551202 20:59819144-59819166 TCCCAAAGTTCTGGGATTGCGGG - Intronic
1176022625 20:62969915-62969937 TCCCAAAGTAGTGGGATTGCAGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177005795 21:15670431-15670453 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1177272642 21:18869639-18869661 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1177644616 21:23885968-23885990 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1177668769 21:24197007-24197029 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1177836048 21:26187304-26187326 TCCCAAAGTTCAGGGATTGCAGG + Intergenic
1178347730 21:31846073-31846095 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1178458181 21:32775551-32775573 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1178948998 21:36970489-36970511 TCCCAAAGTTGTGGGATTACAGG + Intronic
1180660191 22:17460466-17460488 TCCCAAAGTGCAGGGATTGCAGG + Intronic
1180865679 22:19118108-19118130 TCCCAAAGTTACGGGATTGCAGG - Intronic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181350661 22:22255624-22255646 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1181541853 22:23577789-23577811 TCCCAAAGTTGTGGGATTACAGG + Intronic
1181587234 22:23859745-23859767 TCCCAAAGTGCAGGGATTGCAGG + Intronic
1181738081 22:24897725-24897747 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1181742471 22:24932489-24932511 CCCCAAAGTTGAGGGGGTGCTGG - Intergenic
1182806837 22:33079483-33079505 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1183204101 22:36406614-36406636 TCCCTAAGTGCAGGGATTACAGG + Intergenic
1183229620 22:36573588-36573610 TCCCAAAGTGCCGGGAGTGCAGG + Intronic
1183868502 22:40723133-40723155 TCCCTAAGTGCAGGGATTACAGG - Intergenic
1184080907 22:42219595-42219617 TCCCAAAGTTCAGGGATTACAGG - Intronic
1184219537 22:43090585-43090607 TCCCAAAGTACAGGGATTGCAGG - Intergenic
1184345080 22:43908216-43908238 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1184802812 22:46772884-46772906 TCCCAAAGTGCAGGGATTGCAGG + Intronic
950492094 3:13312002-13312024 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
950618786 3:14185090-14185112 TCCCAAAGTGGTGGGATTGCAGG - Intronic
950706269 3:14784388-14784410 TCCCTAGGTTTAGGGGCTGCTGG + Intergenic
951047511 3:18056888-18056910 TCCCAAAGTTGTGGGATTACAGG + Intronic
951526294 3:23656233-23656255 CCCCTTAGGTGGGGGAGTGCGGG + Intergenic
952066150 3:29573373-29573395 TCCCAAAGTTCTGGGATTGCAGG + Intronic
953028623 3:39161174-39161196 TCCCTAAGTTCTGGGATTACAGG + Intergenic
953252324 3:41257371-41257393 TCCCTAAGTTTTGGGATTACAGG - Intronic
953889225 3:46738279-46738301 TCCCAAAGTTCTGGGATTGCAGG - Intronic
953971563 3:47352461-47352483 TCCCAAAGTGGAGGGATTACAGG - Intergenic
954095141 3:48320289-48320311 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
954403173 3:50330058-50330080 ACCCTGAGGTCAGGGAGTGCTGG - Exonic
955221794 3:57029170-57029192 TCCCAAAGTAGTGGGATTGCAGG - Intronic
955737348 3:62053523-62053545 TCCCAAAGTTGTGGGATTACAGG + Intronic
956046658 3:65202955-65202977 TCCCAAAGTTCAGGGACTACAGG - Intergenic
956518829 3:70081369-70081391 TCCCAAAGTGGAGGGATTACAGG + Intergenic
959665107 3:108911845-108911867 TCCCAAAGTTCAGGGATTACAGG - Intronic
959700889 3:109298321-109298343 TCCCTGAGTTCAGGGATTACAGG - Intronic
959895654 3:111603181-111603203 TCCCAAAGTTCTGGGATTGCAGG - Intronic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
960399378 3:117177539-117177561 GCCCAAAGTTGTGGGATTGCAGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
961696793 3:128710806-128710828 TCCCAAAGTTCAGGGATTACAGG + Intergenic
962110196 3:132437135-132437157 TCCCAAAGTACAGGGATTGCAGG + Intronic
962902124 3:139770503-139770525 TCCCAAAGTTCAGGGATTACAGG + Intergenic
964007011 3:151842803-151842825 TCCCAAAGTAGAGGGATTACAGG + Intergenic
964021040 3:152011242-152011264 TCCCAAAGTTCAGGGATTACAGG - Intergenic
964334848 3:155644342-155644364 TCCCTAAGTTCTGGGATTACAGG - Intronic
964510915 3:157450313-157450335 TCCCAAAGTTCTGGGATTGCAGG + Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
964738320 3:159939553-159939575 TCCCAAAGTGGAGGGATTACTGG + Intergenic
964752274 3:160063606-160063628 TCCCAAAGTGGTGGGAGTTCAGG + Intergenic
964917910 3:161858166-161858188 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
965944516 3:174224438-174224460 TCCCAAAGTTCTGGGATTGCAGG - Intronic
966189250 3:177256759-177256781 TCCCAAAGTTGTGGGATTACAGG + Intergenic
967590686 3:191270454-191270476 TCCCAAAGTAGTGGGATTGCAGG + Intronic
968200832 3:196753450-196753472 TCCCTAAGTGCTGGGATTGCAGG + Intronic
968692284 4:1998740-1998762 TCTCTAGGTTGAGGAAGTTCTGG - Intronic
968842018 4:3014533-3014555 TCCCTAAGTGGTGGGATTACAGG - Intronic
969081298 4:4620644-4620666 TGTCTAAGTTGAGAGAGTTCTGG - Intergenic
969748423 4:9092241-9092263 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
970359519 4:15294605-15294627 TTCCTGATTTGAGGGAGTTCAGG + Intergenic
970933199 4:21537753-21537775 TCCCAAAGTTCAGGGATTACAGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972455062 4:39246245-39246267 TCCCAAAGTGCAGGGATTGCAGG - Intronic
972465445 4:39351701-39351723 TCCCAAAGTGGAGGGATTACAGG - Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972693877 4:41425603-41425625 TCCCTAAGTTCTGGGATTACAGG + Intronic
972942876 4:44218390-44218412 TCCCAAAGTGGTGGGAGTACAGG + Intronic
972997664 4:44902114-44902136 TCCCTGAGTTAAGATAGTGCTGG - Intergenic
974263149 4:59551001-59551023 TCCCTAAGTTCTGGGATTACAGG - Intergenic
974438497 4:61886903-61886925 TCCCAAAGTTCTGGGAGTACAGG + Intronic
974439088 4:61893967-61893989 TCCCAAAGTTCTGGGAGTACAGG + Intronic
974973615 4:68862179-68862201 TCCCAAAGTGCAGGGACTGCAGG + Intergenic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
975089565 4:70386013-70386035 TCCCAAAGTTCTGGGATTGCAGG - Intronic
975452946 4:74551336-74551358 TCCCAAAGTGGAGGGATTACAGG - Intergenic
975830875 4:78367144-78367166 TCCCTAAGTGGTGGGATTACAGG - Intronic
975868854 4:78755933-78755955 TCCCAAAGTAGAGGAATTGCAGG - Intergenic
976226881 4:82801082-82801104 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
976997798 4:91457406-91457428 TCCCAAAGTGTAGGGAGTACAGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978798033 4:112728034-112728056 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
979046765 4:115876620-115876642 TCCCTAAGTTCTGGGATTACAGG - Intergenic
979257021 4:118616831-118616853 TCCCTAAGTTCTGGAATTGCAGG + Intergenic
979331328 4:119423715-119423737 TCCCTAAGTTCTGGAATTGCAGG - Intergenic
979566090 4:122155580-122155602 TCCCTAAGTGGTGGGATTACAGG + Intronic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980383203 4:132054281-132054303 TCACTAAGTGGATTGAGTGCTGG + Intergenic
980395158 4:132203664-132203686 TCCCAAAGATGAGGAAGTACTGG + Intergenic
981170618 4:141618930-141618952 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
981553979 4:145971794-145971816 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
982226738 4:153173707-153173729 TCCCAAAGTGCAGGGATTGCAGG - Intronic
982667788 4:158287990-158288012 TCCCAAAGTTCAGGGATTACAGG - Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983021841 4:162686170-162686192 TCCCAAAGTGCTGGGAGTGCTGG + Intergenic
985056643 4:186041639-186041661 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
985322744 4:188733067-188733089 TCCCAAAGTTCAGGGATTACAGG + Intergenic
986327566 5:6687802-6687824 TCCCTGAGATGTGGGAGAGCTGG - Intergenic
986398240 5:7352206-7352228 TCCCAAAGTTATGGGATTGCAGG - Intergenic
986671603 5:10147460-10147482 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
986726155 5:10598697-10598719 TCCCAAAGTTCTGGGATTGCAGG + Intronic
987015148 5:13810480-13810502 TCCCAAAGTGGTGGGAGTACAGG - Intronic
987365911 5:17148449-17148471 TCCCAAAGTGGTGGGAGTACAGG + Intronic
987543167 5:19280725-19280747 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
988115022 5:26875723-26875745 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
988158642 5:27490214-27490236 TCCCAAAGTTGTGGGATTACAGG - Intergenic
988916396 5:35898109-35898131 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
989397886 5:40977873-40977895 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
989844006 5:46116572-46116594 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
990308185 5:54513345-54513367 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
991399889 5:66241224-66241246 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
991475787 5:67017853-67017875 TCCCAAAGTGCAGGGATTGCAGG + Intronic
991577018 5:68115224-68115246 TCCCTAAGTGGTGGGATTACAGG + Intergenic
991583233 5:68178024-68178046 TCCCAAAGTGGAGGGATTACAGG - Intergenic
991707911 5:69377010-69377032 TCCCTAAGTGCTGGGATTGCAGG + Intronic
991775062 5:70076265-70076287 TCCCAAAGTTGTGGGATTGTAGG + Intronic
991854355 5:70951685-70951707 TCCCAAAGTTGTGGGATTGTAGG + Intronic
992205537 5:74427147-74427169 TCCCTGAGGTTAGGGAGGGCAGG - Intergenic
992717772 5:79528069-79528091 TCCCAAAGTTCAGGGATTACAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993644601 5:90446914-90446936 TCCCAAAGTTGTGGGATTACAGG + Intergenic
993923206 5:93832544-93832566 TTCCTTAGCTGTGGGAGTGCTGG + Intronic
994290053 5:98018713-98018735 TCCCAAAGTTTAGGGATTACAGG + Intergenic
994748761 5:103711958-103711980 TCCCAAAGTGAAGGGAGTACAGG + Intergenic
994942739 5:106345893-106345915 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
995108032 5:108397755-108397777 TCCCTAAGTTCTGGGATTACAGG + Intergenic
995149857 5:108830193-108830215 TCCCAAAGTTCTGGGATTGCAGG - Intronic
995167275 5:109058996-109059018 TCCCTAAGTGGTGGGATTACAGG + Intronic
996006949 5:118432837-118432859 TCCCAAAGTGGTGGGATTGCAGG - Intergenic
996047317 5:118887897-118887919 TCCCAAAGTTGTGGGATTACAGG + Intronic
997291959 5:132743313-132743335 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
997565061 5:134880699-134880721 TCCCTAAGTGCTGGGAGTACAGG + Intronic
997761413 5:136451771-136451793 TCCATAAGTTGTGGGGGTACAGG - Intergenic
998263494 5:140649093-140649115 TCCCAAAGTGGTGGGAGTACAGG + Intronic
998839278 5:146235946-146235968 TCCCAAAGTTCAGGGATTACAGG + Intronic
1000099968 5:158006650-158006672 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1000897353 5:166871915-166871937 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1001389684 5:171368912-171368934 TCCCTGAGTTGAGGTAGCGTTGG + Intergenic
1001503325 5:172255828-172255850 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1001811278 5:174630129-174630151 TCCCTAAGTGCTGGGATTGCGGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003645722 6:7911364-7911386 TCCCTGAGTTGAGGCCGGGCAGG - Intronic
1003917368 6:10799787-10799809 TCCCTAAGTTCTGGGATTACAGG - Intronic
1004197489 6:13518121-13518143 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1004723000 6:18284775-18284797 TCCCTAAGTGGCGGGATTACAGG - Intergenic
1005258781 6:24034190-24034212 TCCCAAAGTGCAGGGAGTACAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005479435 6:26241354-26241376 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1005487791 6:26317622-26317644 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1005698841 6:28379341-28379363 TCCCAAAGTTCAGGGATTACAGG - Exonic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006122077 6:31813561-31813583 TCCCTAAGTTCTGGGATGGCAGG + Intronic
1006148666 6:31974457-31974479 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1006758775 6:36441006-36441028 TCCCTAAGTTTGGGGATTACAGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006964255 6:37966019-37966041 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1006975663 6:38098406-38098428 TCCCAAAGTTGTGGGATTACAGG + Intronic
1007218935 6:40263242-40263264 TCCCAAAGTTGTGGGACTACAGG - Intergenic
1008275546 6:49540005-49540027 TCCCAAAGTTTTGGGATTGCAGG - Intergenic
1008943897 6:57076140-57076162 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1009291532 6:61888817-61888839 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1011609615 6:89138181-89138203 TCCCTAAGTGTTGGGAGTACAGG + Intergenic
1011611623 6:89157187-89157209 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1011616340 6:89201519-89201541 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1012245523 6:96922182-96922204 TCCCTCAGTTGTGGTAGTGTGGG - Intergenic
1012267465 6:97163359-97163381 TAACTCAGATGAGGGAGTGCAGG + Intronic
1012298631 6:97556156-97556178 TCCCCAAGTGAAGGGAGTTCAGG + Intergenic
1012929237 6:105299338-105299360 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1013094938 6:106936015-106936037 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1013151912 6:107454304-107454326 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1013181105 6:107717804-107717826 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1013785087 6:113770319-113770341 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1013801914 6:113955767-113955789 TCCCAAAGTGGAGGGATTACAGG + Intronic
1014439539 6:121458416-121458438 TCCCTAAATTCTGGGATTGCAGG + Intergenic
1014519437 6:122422818-122422840 TCCCTAAGTTCAGGCAGTGATGG + Exonic
1014601334 6:123416959-123416981 TCCCAAAGTTGTGGGATTACAGG + Intronic
1014886358 6:126786282-126786304 TCCCAAAGCTGAGGGACTGGTGG + Intergenic
1014972183 6:127830425-127830447 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1015089152 6:129333148-129333170 TCCCAAAGTTCAGGGATTACAGG + Intronic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1015921033 6:138266589-138266611 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1016493754 6:144635795-144635817 TCCCAAAGTTCTGGGAGTACAGG + Intronic
1017079636 6:150655448-150655470 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1018494085 6:164330314-164330336 TCCCAAAGTTTTGGGATTGCAGG - Intergenic
1018498855 6:164380647-164380669 TCCCAAAGTGCAGGGATTGCAGG + Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019009726 6:168834352-168834374 TCCCTAAGATGGGGGAGAGGAGG - Intergenic
1019163534 6:170084583-170084605 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1019398721 7:838174-838196 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1019672762 7:2291033-2291055 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1019683010 7:2363192-2363214 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1019699363 7:2466539-2466561 TCCCTAAGTGCTGGGAGTTCAGG + Intergenic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1019897345 7:3992505-3992527 TCCCTGCATTGAGAGAGTGCAGG + Intronic
1019938143 7:4269663-4269685 TCCCTAAGTGCTGGGACTGCAGG + Intergenic
1019943189 7:4307361-4307383 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1020049215 7:5070954-5070976 TCCCTAAGTTCTGGGATTACAGG + Intronic
1020447077 7:8280358-8280380 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1020569832 7:9845269-9845291 TCCCGAAGTTCTGGGACTGCAGG - Intergenic
1020738990 7:11989465-11989487 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1021542907 7:21780284-21780306 TCCCTAAGTGCAGGGATTACAGG - Intronic
1021582585 7:22172380-22172402 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1021640412 7:22730746-22730768 TCCCAAAGTTTAGGGAATACAGG - Intronic
1021734292 7:23627847-23627869 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1022390330 7:29938288-29938310 TCCCAAAGTGCTGGGAGTGCGGG + Intronic
1022485850 7:30777131-30777153 TCTCAAAGTTCAGGGACTGCAGG + Intronic
1022670262 7:32448991-32449013 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023560808 7:41471502-41471524 TCCCTAAGTACTGGGAGTACAGG - Intergenic
1023903947 7:44507916-44507938 TCCCAAAGTTCTGGGATTGCTGG + Intergenic
1023963749 7:44949973-44949995 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024643070 7:51347535-51347557 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1025152438 7:56569197-56569219 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1025275329 7:57577900-57577922 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1025752715 7:64307305-64307327 TCCCTAGGTTGCAGGACTGCAGG - Intergenic
1026220446 7:68392009-68392031 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1026388860 7:69879406-69879428 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1026812356 7:73479248-73479270 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1027001981 7:74659799-74659821 TCCCAAAGTGGTGGGAGTACAGG + Intronic
1027134210 7:75612548-75612570 TCCCAAAGTTCAGGGATTACGGG - Intronic
1027206420 7:76103513-76103535 TCCCAAAGTGGTGGGACTGCAGG - Intergenic
1027404907 7:77850090-77850112 TCCCGAAGTTCTGGGATTGCAGG - Intronic
1027688636 7:81311666-81311688 TCCCTGAGTTGATGCATTGCCGG + Intergenic
1027931529 7:84541783-84541805 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1028156345 7:87434198-87434220 TCCCAAAGTTGTGGGATTACAGG + Intronic
1028560952 7:92175387-92175409 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1029281038 7:99435695-99435717 TCCCAAAGTGCTGGGAGTGCAGG - Intronic
1029491401 7:100872425-100872447 TCCCAAAGTCGGGGGATTGCAGG + Intronic
1029523346 7:101078800-101078822 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1029556092 7:101270325-101270347 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1030713760 7:112785947-112785969 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1031775755 7:125907095-125907117 TCCCAAAGTTCTGGGACTGCAGG + Intergenic
1031889194 7:127274484-127274506 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1032070534 7:128803390-128803412 TCCCAAAGTGGTGGGAGTACAGG - Intronic
1032391755 7:131559559-131559581 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032681609 7:134190464-134190486 TCCCAAAGTACAGGGATTGCAGG + Intronic
1032720400 7:134546784-134546806 CCCCTAGGTTGAGGGAGATCAGG + Intergenic
1032863403 7:135903014-135903036 TCCCAAAGTGCAGGGATTGCAGG - Intergenic
1032960293 7:137025888-137025910 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034433349 7:151051661-151051683 TCCCAAAGTGCAGGGAGTACAGG + Intronic
1035535352 8:386707-386729 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1035694916 8:1588641-1588663 TCCCAAAGTTGTGGGATTACAGG - Intronic
1036464934 8:8988050-8988072 TCCCAAAGTTTTGGGATTGCAGG - Intergenic
1036508887 8:9382250-9382272 TCCCTAAGTTTTGGGATTACAGG + Intergenic
1037436706 8:18870839-18870861 TCCCTAAGTGGTGGGATTACAGG - Intronic
1038455257 8:27668599-27668621 TCCCAAAGTTTTGGGATTGCAGG - Intronic
1038614473 8:29080081-29080103 TCCCAAAGTGGTGGGATTGCAGG - Intronic
1038807590 8:30809680-30809702 TCCCAAAGTGCAGGGATTGCGGG - Intronic
1038967862 8:32595445-32595467 TCCGTAAGTTGGGGGATTACAGG + Intronic
1039169134 8:34721864-34721886 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1039288589 8:36069383-36069405 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
1039486562 8:37914751-37914773 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1039526247 8:38218786-38218808 TCCCAAAGTTGTGGGATTACAGG + Intergenic
1039606857 8:38888010-38888032 TCCCAAAGTGTTGGGAGTGCAGG + Intergenic
1039634279 8:39145988-39146010 TCCCTAAGTTTTGGGATTACAGG + Intronic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040607566 8:48949631-48949653 TCCCTAGGTTCAGGTAGAGCTGG - Intergenic
1040810599 8:51448444-51448466 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1040926182 8:52686283-52686305 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1041038487 8:53820721-53820743 TCCCAAAGTTGTGGGATTACAGG - Intronic
1041399532 8:57427588-57427610 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1041558920 8:59191851-59191873 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1042289970 8:67160138-67160160 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043172357 8:76981210-76981232 TCCCAAAGTTGTGGGATTACAGG - Exonic
1043654345 8:82643125-82643147 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1043888475 8:85630234-85630256 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1043941769 8:86204443-86204465 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1044664060 8:94618276-94618298 TCCCAAAGTGTAGGGATTGCAGG - Intergenic
1044706439 8:95013362-95013384 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1045465231 8:102463470-102463492 TCCCCAAGTGGAGTGATTGCGGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047004409 8:120604707-120604729 TCCCAAAGTGGTGGGATTGCAGG + Intronic
1047116321 8:121845252-121845274 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1047380975 8:124362401-124362423 TCCCAAAGTTGTGGGATTACAGG - Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047644940 8:126860636-126860658 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1049244883 8:141557128-141557150 TCACTAAGATGAGGTAGCGCTGG - Intergenic
1049439703 8:142603705-142603727 TCCCTAAGTGCTGGGATTGCAGG + Intergenic
1050087898 9:1985658-1985680 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1050189840 9:3013355-3013377 TCCCGAAGTTCTGGGATTGCAGG - Intergenic
1052056380 9:23912159-23912181 TTCCTAAGTTGGTGCAGTGCAGG + Intergenic
1053061755 9:35037302-35037324 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1053170832 9:35881258-35881280 TCCCAAAGTTCAGGGATTACAGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054267930 9:62937935-62937957 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055018902 9:71648071-71648093 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1055294354 9:74819047-74819069 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1055954359 9:81760568-81760590 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1055957950 9:81791944-81791966 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057334606 9:94146133-94146155 TCCCAAAGTGCTGGGAGTGCAGG + Intergenic
1057601631 9:96463202-96463224 TCCCAAAGTTCTGGGATTGCAGG + Intronic
1058010513 9:99971760-99971782 TCCCTAAGTGCTGGGATTGCAGG - Intergenic
1059606166 9:115838771-115838793 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1060081582 9:120652225-120652247 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060615356 9:125008101-125008123 TCCCAAAGTTCAGGGATTACAGG + Intronic
1060633097 9:125177436-125177458 TCCCTAAGTGGTGGGATTACAGG - Intronic
1061029566 9:128071969-128071991 TCCCAAAGTTCAGGGATTACAGG + Intronic
1061161389 9:128896980-128897002 TCCCTAAGTTCTGGGATTACAGG + Intronic
1061771403 9:132926202-132926224 TCCCAAAGTGCAGGGATTGCCGG - Intronic
1061840041 9:133353379-133353401 GCCCTACCTTGAGGGAGTGGAGG - Intronic
1062039624 9:134398236-134398258 TCCCAAAGTTGTGGGATTACAGG + Intronic
1062724877 9:138066321-138066343 TCCCAAAGTTCTGGGAGTACAGG - Intronic
1185485592 X:479246-479268 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1185547986 X:961142-961164 TCCCCAAGTTGGGAGAGTTCAGG - Intergenic
1185573181 X:1150373-1150395 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1185599192 X:1327389-1327411 TCCCTAAGTGGTGGGATTACAGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186484634 X:9924612-9924634 TCCCTAAGTGTTGGGATTGCAGG + Intronic
1186890329 X:13953505-13953527 TCCCAAAGTGCTGGGAGTGCAGG - Intergenic
1186985556 X:15009857-15009879 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1187302693 X:18066291-18066313 TCCCTTAATTGAGGCAGTTCAGG - Intergenic
1187333033 X:18357999-18358021 TCCCAAAGTGGAGGGATTACAGG - Intergenic
1187656882 X:21485874-21485896 TCCCAAAGTTCTGGGATTGCAGG - Intronic
1187754682 X:22509571-22509593 TCCCAAAGTGGTGGGATTGCAGG + Intergenic
1187856270 X:23638543-23638565 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1188191317 X:27174512-27174534 TCCCAAAGTTCTGGGATTGCAGG + Intergenic
1189113912 X:38324356-38324378 TCCCTAAGTGCTGGGATTGCAGG + Intronic
1189280221 X:39815996-39816018 TCCCTCAGTCCAGGGAGTGGTGG - Intergenic
1189295731 X:39916213-39916235 TCCCAAAGTCCAGGGATTGCAGG - Intergenic
1189765327 X:44366442-44366464 TCCCTAAGTTCTGGGATTACAGG - Intergenic
1190120438 X:47655020-47655042 TCCCTAAGTGCTGGGATTGCAGG - Intronic
1190411123 X:50138306-50138328 TCCCAAAGTTGTGGGATTACAGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190558802 X:51667024-51667046 TCCCAAAGTGGTGGGAGTACAGG - Intergenic
1190714398 X:53091568-53091590 TCCCCCAGTTGGGGGTGTGCAGG + Intergenic
1190761962 X:53444389-53444411 TCCCTAAGTGTTGGGATTGCAGG - Intergenic
1190904477 X:54712059-54712081 TCCCTAAGTTCTGGGATTACAGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1191787232 X:64929149-64929171 TCCCAAAGTTGTGGGACTACAGG + Intronic
1191859686 X:65656023-65656045 TCCCAAAGTTCAGGGATTACAGG + Intronic
1193138695 X:78002338-78002360 TCCCGAAGTTCTGGGATTGCAGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193909559 X:87285730-87285752 TCCCTAAATTCAGGCACTGCTGG + Intergenic
1194124737 X:90002146-90002168 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1194926169 X:99827409-99827431 TCCTTAAGTTGTTGGAGTACAGG + Intergenic
1196394481 X:115244527-115244549 TCCCAAAGTTTTGGGATTGCAGG - Intergenic
1196764057 X:119226905-119226927 TCCCAAAGTTCAGGGATTACAGG - Intergenic
1196823062 X:119718720-119718742 TCCCAAAGTTCTGGGAGTACAGG - Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1197787740 X:130216738-130216760 TCCCAAAGTTCAGGGAGTACAGG - Intronic
1199279547 X:145984711-145984733 TCCCAAAGTTCTGGGATTGCAGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200477629 Y:3659756-3659778 TCCCAAAGTTCTGGGAGTACAGG + Intergenic
1200548593 Y:4550271-4550293 TCCCTAAGTGGTGGGATTACAGG + Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201988842 Y:20002141-20002163 TCCCAAAGTGCAGGGACTGCAGG + Intergenic
1202026255 Y:20527194-20527216 TCCCCAAGTTCTGGGAGTACAGG - Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic