ID: 1087873732

View in Genome Browser
Species Human (GRCh38)
Location 11:103330743-103330765
Sequence CCTCTTGTACTGAAACTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1087873725_1087873732 22 Left 1087873725 11:103330698-103330720 CCTTTATGACAACGCTATTCTCT 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1087873724_1087873732 23 Left 1087873724 11:103330697-103330719 CCCTTTATGACAACGCTATTCTC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 75
1087873726_1087873732 -7 Left 1087873726 11:103330727-103330749 CCTTCATGTCCCTCCTCCTCTTG 0: 1
1: 0
2: 8
3: 71
4: 725
Right 1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1087873732 Original CRISPR CCTCTTGTACTGAAACTGGC CGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
906288109 1:44601571-44601593 CCTGTTCCACTGAAACTGGAGGG + Intronic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
914454193 1:147820356-147820378 CCTTTTGTAATGAAAATGGGTGG + Intergenic
915465965 1:156098090-156098112 CCTTTTGTACTGAAATTGTGTGG - Intronic
919014157 1:192008442-192008464 CTTCTTGTACTGTTTCTGGCTGG - Intergenic
924541101 1:244981569-244981591 CCTTTTGAGCTGAAACTGGAAGG - Intronic
1072504166 10:96047474-96047496 CCTGTTGTACAGAAACTAACTGG + Intronic
1078780957 11:14439015-14439037 CCTCTTTCTCTGAGACTGGCAGG + Intergenic
1083426692 11:62591683-62591705 CCGCTTTTCCTGAAACGGGCGGG - Intronic
1087125339 11:94620123-94620145 CCACCTGTACTACAACTGGCCGG + Exonic
1087394695 11:97583143-97583165 CCACTTGTACTGTTACTGGCTGG + Intergenic
1087873732 11:103330743-103330765 CCTCTTGTACTGAAACTGGCCGG + Intronic
1090807620 11:130212212-130212234 CCTCCTGAACAGAAACTGGTGGG + Intergenic
1091351760 11:134903488-134903510 CCTCTTGTATTAAAGCTTGCTGG - Intergenic
1091635872 12:2196144-2196166 CCTTTTGTACTTAAAGTGGATGG + Intronic
1095979896 12:47966144-47966166 GTTCATGTACTGAATCTGGCTGG - Exonic
1099739648 12:86617094-86617116 CCTCATGGACTGAAACAGGTTGG + Intronic
1105934329 13:25085364-25085386 CATCTTTTCTTGAAACTGGCAGG - Intergenic
1107432485 13:40352406-40352428 CCTAGTGTGCTGAAACAGGCTGG + Intergenic
1110929529 13:81197321-81197343 CCTCTTCTTCTGAAATTTGCTGG - Intergenic
1115721773 14:36169679-36169701 CATTTTGTACAGAAACTGGGAGG - Intergenic
1115854041 14:37611007-37611029 CCTCTTGGACTGAAGCCGCCTGG - Intronic
1117240181 14:53824321-53824343 GCTTTTGTGCAGAAACTGGCTGG - Intergenic
1119755606 14:77116556-77116578 CATCTTTTACTGAAACAGGGAGG - Exonic
1125791132 15:42366690-42366712 CCTCTTGTAAGTAAACGGGCAGG - Intronic
1128424031 15:67521440-67521462 CCTCTCGCACTTCAACTGGCCGG + Exonic
1128515704 15:68340619-68340641 CCCCTTGTCCTGCAACTGGTGGG - Intronic
1129055745 15:72818832-72818854 CCTCTTGCATTCAAACTGTCTGG - Intergenic
1131944967 15:97609524-97609546 TCTATTGTACTGCATCTGGCTGG - Intergenic
1132519535 16:381105-381127 CCTCTTGTTGGGAAACTCGCCGG - Intronic
1132931744 16:2462273-2462295 CCTCTAGCTCTGAACCTGGCAGG + Intronic
1134677805 16:16102757-16102779 CCTCTTGTCCTCCCACTGGCAGG - Intronic
1134685339 16:16154651-16154673 ACACTTGTACTGCAGCTGGCCGG + Exonic
1136399401 16:30009658-30009680 CCTCTTGCACTCACACTCGCGGG - Intronic
1159008769 18:63038880-63038902 CCTCTCTTACTGAACCTGTCTGG - Intergenic
1160130166 18:76218354-76218376 CCTCATGCACTGGAACTGGAAGG - Intergenic
925299301 2:2799242-2799264 CCTCTTTTATTGCAAATGGCTGG + Intergenic
926312994 2:11687957-11687979 GCTCTGGGACTGAAGCTGGCTGG + Intronic
932658464 2:73630852-73630874 CCTCTAGTGGTGAAACAGGCTGG - Intergenic
932665075 2:73690859-73690881 CCTCTAGTGGTGAAACAGGCTGG - Intergenic
937648515 2:124294457-124294479 CCTCTGGTACTAAAGATGGCTGG - Intronic
938389925 2:130897021-130897043 CCTCTTTCACTGAACCTCGCAGG - Intronic
942231713 2:173866618-173866640 CCTGTTCCACTGAAGCTGGCAGG - Intergenic
943613874 2:190068807-190068829 CCCCTCTTCCTGAAACTGGCAGG + Intronic
943870998 2:192999209-192999231 CCTCTTATATTCAAACTGACAGG - Intergenic
1173297922 20:41775740-41775762 TTTATTGTACTGAAACTGACTGG + Intergenic
1177450623 21:21260354-21260376 CATCTTGTACTGTAACTTGCAGG - Intronic
1181533660 22:23531009-23531031 CTTCTTGTACTGAAAGTATCAGG + Intergenic
949954539 3:9256790-9256812 CCTCTGGTTCTGCAACTGCCTGG + Intronic
953447155 3:42978459-42978481 CCTCCAGTACTGAAACTAACAGG - Intronic
958762116 3:98321450-98321472 GCTCTTGTTCTGCTACTGGCTGG - Intergenic
959386352 3:105713317-105713339 CCTCTTGGAGTGAAACTGCCTGG - Intronic
960590059 3:119357000-119357022 TCTCATGCACTGCAACTGGCAGG - Intronic
961911089 3:130317403-130317425 GCTCTAGTACTGACACTGGGAGG + Intergenic
961919558 3:130411792-130411814 CCTCATGTCCTGTAATTGGCTGG - Intronic
965495635 3:169395324-169395346 CCAATTTTACTGAAATTGGCTGG + Intronic
986125583 5:4880272-4880294 CTTTTTGTGCTGACACTGGCGGG + Intergenic
987508537 5:18804785-18804807 TCTCCTGAACTTAAACTGGCTGG - Intergenic
991416524 5:66398341-66398363 TCTCTTGTACTGAAGCAGGTTGG - Intergenic
995013573 5:107285482-107285504 CCCCTTGCTTTGAAACTGGCAGG - Intergenic
1009476939 6:64104287-64104309 CCTCTTGTACTGAAATCTGATGG + Intronic
1017415211 6:154213192-154213214 CCTAATGAATTGAAACTGGCAGG + Intronic
1018913785 6:168120538-168120560 CCTCTTGTTCTGTGATTGGCAGG + Intergenic
1018972134 6:168536974-168536996 ACTCTTGTCCTGACACTGGCAGG - Intronic
1034500346 7:151446744-151446766 CCACTGGTACTGACAGTGGCTGG - Intergenic
1036711015 8:11078626-11078648 CCTCTTGTCTTGAGACTCGCAGG - Intronic
1041409465 8:57537109-57537131 CCTCTGAGGCTGAAACTGGCAGG - Intergenic
1042786258 8:72550272-72550294 CTTCTTATACTCTAACTGGCTGG + Intronic
1045220812 8:100198212-100198234 TCTCTTGTGCTAGAACTGGCAGG + Intronic
1048289229 8:133167494-133167516 CCTCCTGTAATGAAGCTGCCTGG - Intergenic
1051664576 9:19456728-19456750 CCTCTTTTTCTGAGTCTGGCTGG + Intergenic
1055001011 9:71448384-71448406 TCTCTTTTACTTAAAATGGCAGG - Intergenic
1060497106 9:124126893-124126915 CCTCTTGGAAAGAAACTTGCTGG + Intergenic
1061166170 9:128923376-128923398 CCTCCTTTATTGAAGCTGGCAGG - Intronic
1186283564 X:8020141-8020163 GCTCTTGTATTGACACTAGCTGG + Intergenic
1187305754 X:18093868-18093890 GCTCTTGTCCTCAAAATGGCAGG - Intergenic
1189308212 X:40003184-40003206 CCTCTTGGACTGAAGGAGGCCGG + Intergenic
1189619470 X:42820512-42820534 CCACTTGTTCTGACACTGACTGG - Intergenic
1192269494 X:69565342-69565364 CCTCTTGTACTAAAACTGAAAGG + Intergenic
1192308775 X:69991486-69991508 CTTCTAGTAGTGAAACTGGATGG - Intronic